Skip to content

Мастер класс шишки из лент: ШИШКА НоВоГоДнЯя ИЗ ЛЕНТ / DIY: Christmas Pine Cone with Ribbons ✿ NataliDoma

Содержание

идеи, мастер-класс. Поделки из шишек на Новый год

Шишки – это прекрасный материал, из которого можно изготовить разнообразные поделки. К тому же они обладают утонченным приятным ароматом хвои. Конечно, изначально такой материал выглядит не очень привлекательно. Однако если подключить фантазию, то из шишек можно сделать оригинальные украшения для праздника. При этом особых затрат не требуется. Сделать новогодний декор из шишек может практически каждый. Как же это сделать?

Подготовка материала

Декор из шишек всегда выглядит необычайно и красиво. Главное, знать, как правильно подготовить материал для поделок. Шишки, которые упали с дерева еще закрытыми, со временем постепенно раскрываются. При этом сосновые внешне напоминают небольшие елочки, а еловые – взъерошенных ежат. Конечно, изначально декор из шишек выглядит необычайно. Однако со временем поделки начинают деформироваться. Чтобы этого избежать, при обработке материалов стоит придерживаться определенных правил:

  1. Чтобы избежать раскрытия шишек даже при перепадах температуры в помещении, следует опустить их на 30 секунд в столярный клей.
  2. Чтобы шишки, напротив, быстрее раскрылись, рекомендуется в течение получаса их проварить, а затем просушить на батарее. Также материал можно прожарить в духовке при 250 °С на протяжении 2 часов. Эти методы позволяют не только добиться желаемого результата, но и убить все бактерии. Материал после обработки будет безопасным и чистым.
  3. Чтобы декор из шишек получился красивым, можно подкорректировать форму материала. Достаточно вымочить сырье для поделки в воде, а затем перевязать в нужном месте веревочкой и просушить.
  4. Чтобы материал стал более светлым, можно его отбелить. Для этого шишки рекомендуется замочить в емкости с отбеливателем на 5 часов. При этом стоит соблюдать пропорции. На одну часть воды требуется одна часть отбеливателя. В завершение шишки необходимо тщательно промыть и обсушить.

Какой декор из шишек можно сделать

Еловые и сосновые шишки – это натуральный природный материал, с которым легко работать. Для изготовления декора из такого сырья достаточно один раз прогуляться по лесу и собрать необходимое количество материала. После тщательной подготовки из шишек можно изготовить оригинальные и красивые вещи. При этом можно сэкономить на покупках дорогих новогодних украшений для помещения и для елки.

Стоит отметить, что из такого материала можно изготовить множество интересных элементов декора. Это могут быть миниатюрные елочки, украшения для елки, венок для свечей либо входных дверей и так далее. Из такого материала можно сделать практически все. Достаточно подключить фантазию.

Как сделать новогоднюю елочку

Проведем небольшой мастер-класс. Из шишек можно изготовить небольшие и оригинальные елочки. Для изготовления подобного декора требуются:

  1. Шишки.
  2. Пистолет клеевой.
  3. Ножницы.
  4. Баллончики с золотой либо серебряной краской.
  5. Круг и конус из картона. Лучше использовать материал коричневого либо зеленого цвета.

Этапы изготовления

Итак, как сделать декор из шишек? Для начала стоит подобрать и подготовить материал. Шишки лучше брать уже раскрытые. Материал следует очистить от мусора, хорошо промыть и высушить.

После этого шишки необходимо покрыть равномерным слоем краски. Так материал приобретет более праздничный вид. При желании этого можно не делать, если хотите сохранить натуральность. Если шишки были окрашены, то их следует хорошо просушить.

К конусу необходимо приклеить круг. Двигаясь по кругу, на поверхности конструкции следует зафиксировать подготовленные шишки. Начинать стоит с самых больших, постепенно уменьшая размер материала. Шишки должны плотно прилегать друг к другу. Необычайная елочка готова. При желании ее можно украсить. Необычайный декор из шишек способен придать интерьеру более праздничный вид.

Шар для вечеринки

Поделки из шишек на Новый год могут заменить даже самые нестандартные вещи. Например, многие видели на больших вечеринках светящиеся шары, висящие под потолком. Подобный элемент интерьера можно изготовить из сосновых шишек. Для создания такой поделки потребуются:

  1. Шарик воздушный.
  2. Бумага туалетная.
  3. Клей ПВА.
  4. Краска коричневого цвета.
  5. Шишки.
  6. Лента.

Делаем заготовку для шара

Такие поделки из шишек на Новый год можно изготавливать несколькими способами. Для начала стоит сделать заготовку. Ее можно приобрести уже готовой, а можно изготовить своими руками. Последний вариант более интересен. Следует взять воздушный шарик и надуть его до необходимых размеров. Теперь его стоит обклеить. Для этого шарик необходимо обмотать туалетной бумагой, предварительно смоченной в растворе клея ПВА. Его также можно сделать в домашних условиях. Для этого следует смешать 1 часть клея ПВА и 2 части воды. Шар, покрытый не одним слоем туалетной бумагой, стоит оставить на 24 часа для высыхания.

Спустя указанное время заготовку рекомендуется покрыть коричневой краской. В противном случае материал будет просвечиваться сквозь шишки. Теперь ее следует просушить.

Делаем шар

Когда заготовка готова, остается приклеить к ней аккуратно заранее подготовленные шишки. При этом не стоит спешить. Шишки должны располагаться плотно друг к другу. Сверху нужно приклеить атласную ленту. Поделка готова. Повесить ее можно под потолком или же на люстру.

При желании в такой шар можно воткнуть палочку, поместив ее второй конец в горшок. Получится своеобразный топиарий.

Венок из шишек

Из еловых шишек также можно сделать необычайное украшение. Чаще всего их используют для создания новогоднего венка. Традиционно такое изделие плетется из еловых ветвей. Однако в последнее время венки стали изготавливать из атласных лент и новогодней мишуры, украшая все это шарами и бумажными цветами. При желании можно создать рождественские украшения из шишек. Для работы потребуются:

  1. Степлер.
  2. Скотч.
  3. Газеты.
  4. Шишки еловые.
  5. Краска в баллончике, желательно коричневая.
  6. Ножницы.
  7. Пистолет клеевой.
  8. Бусинки, ленточки, ветки ели и прочее.

Приступаем к работе

В первую очередь необходимо сделать основу будущего венка. Если нет времени, то можно приобрести уже готовую в специализированном магазине. Если же такой возможности нет, то основы для венка следует изготовить самостоятельно. Это обойдется гораздо дешевле. Газету необходимо скрутить в длинную трубку, а затем свернуть бубликом. Края материала можно скрепить при помощи степлера. Такую заготовку рекомендуется дополнительно обмотать нарезанной газетой, а затем скотчем. Это не позволит готовому изделию деформироваться.

Чтобы скрыть материал основы, следует покрыть заготовку равномерным слоем краски. После полного высыхания покрытия, можно приклеить шишки, заполнив ими все пространство. В завершение венок стоит красиво украсить, используя атласные ленточки, бусины и веточки. Готовый венок рекомендуется покрыть лаком, чтобы сохранить его на длительное время.

Звезда из шишек

Этот новогодний декор из шишек может стать отличным украшением для ели. Процесс изготовления такой звезды достаточно прост. Для работы потребуются:

  1. Ленточки.
  2. Металлические шпажки либо крепкая проволока.
  3. Шишки еловые различных размеров.

Как же сделать

Из проволоки необходимо сделать 5 одинаковых по длине шпажек. Их следует соединить, перегнув по центру. Это будет основа для пятиконечной звезды. На проволоку необходимо нанизать шишки, собирая оригинальную композицию. Один из прутиков стоит согнуть и обвязать атласной лентой. Это позволит подвешивать готовую поделку возле камина, на стене или на дверях. Такую звезду можно закрепить на верхушке новогодней ели.

Елочные игрушки

При желании можно сделать оригинальный декор из шишек своими руками для новогодней елки. Изделия достаточно просты в изготовлении, долговечны и красивы. Как же простую шишку превратить в произведение искусства?

Самый простой вариант – это использование старых мягких игрушек небольших размеров. Для начала стоит покрасить подготовленную шишку в соответствующий цвет, а затем прикрепить к ней голову игрушки. Также можно добавить хвост, лапы и крылья. В итоге получается оригинальная елочная игрушка.

Существует еще более простой способ изготовления подобных поделок. Для начала стоит покрасить шишки в нужный цвет или же покрыть блестками. В завершение к игрушке необходимо прикрепить аккуратный бантик из атласной ленты либо несколько веточек сосны, а также веревочку. Поделка готова осталось повесить ее на елку.

При помощи войлока и фетра можно создать оригинальных сказочных персонажей из обычных шишек. Самое главное, крепко склеить все детали. В противном случае игрушка со временем начнет рассыпаться.

Для изготовления украшений для елки можно использовать не только шишки, но и их чешуйки. Перед началом работы их следует аккуратно отделить от основания. Чтобы сделать игрушку, нужна заготовка. Ее можно выполнить в виде фигуры животного. В данном случае для изготовления заготовки можно использовать поролон и папье-маше. К поверхности такого основания стоит аккуратно приклеить чешуйки шишек, а затем украсить все блестками, создав эффект заснеженности.

Занимаемся с детьми

Шишки – это превосходный природный материал, который можно использовать для занятий с детьми. Однако применять для скрепления деталей клей в этом случае не стоит. Обычно для занятий используют пластилин. Стоит отметить, что процесс изготовления фигурок очень нравится детям. К тому же создание поделок позволяет разработать моторику рук, а также повлиять на умственное развитие ребенка. Перед началом занятий следует ознакомиться с несколькими правилами:

  1. Шишки обязательно должны быть хорошо просохшими.
  2. Разнообразие размеров и форм материала позволяет развить фантазию ребенка.
  3. Мелкие детали фигурок можно выполнить из пластилина и прочих пригодных для этого материалов.
  4. Если ребенку исполнилось не более 3 лет, то поделки может делать только из одной шишки. Для детей постарше можно придумать композиции из нескольких.

Лисичка из шишек

Чтобы изготовить лисичку вместе с детьми, потребуются:

  1. Пластилин белого, оранжевого и черного цвета.
  2. Шишки различных форм и размеров.

Для начала стоит подобрать материал, который будет подходить для изготовления туловища, хвоста и головы. Шишки следует соединить между собой при помощи пластилина либо хорошего клея. Заготовка готова. Остается ее украсить. Для этого из пластилина следует вылепить лапки, ушки, глазки, носик и мордочку животного.

Шустрый ежик

Этого зверька можно изготовить из одной красивой и большой шишки, которая уже полностью раскрылась. Ее остается украсить отдельными деталями, выполненными из пластилина. Для завершения нужно слепить 4 лапки, ушки, носик, глазки и мордочку животного.

Также можно слепить из пластилина тело ежика, а затем покрыть его верх чешуйками шишек или же небольшими шишками одинаковых размеров. При желании спинку зверька можно украсить грибочками и яблоками. Их можно слепить из пластилина.

Шишки и желуди

Декор из шишек к Новому году будет выглядеть более оригинально, если для его изготовления использовать желуди. Из таких материалов можно создать красивые елочные игрушки. Для работы над декором потребуется:

  1. Желуди.
  2. Шишки.
  3. Тонкая атласная лента.
  4. Синтепон или пух.
  5. Клеевой пистолет.

Процесс изготовления гнома

С желудя следует снять шапку, а затем проделать в нем отверстие. Через него необходимо протянуть тонкую ленточку и зафиксировать, сделав аккуратный узелок. Между желудем и его шляпкой стоит положить кусочек синтепона и закрепить все при помощи клея. Это будет голова гнома.

На шишку стоит приклеить немного синтепона так, чтобы получилась борода. Теперь нужно соединить туловище с головой, проклеив все клеем. Поделка готова.

В завершение

Шишки, каштаны и желуди – это натуральные материалы, которые можно использовать для изготовления оригинальных поделок. Они могут быть не просто напоминанием о проведенном с детьми времени, но и отличными новогодними украшениями для дома и для елочки. Если подойти к процессу изготовления с любовью и должным терпением, то могут получиться необычайные вещи, которые сложно будет отличить от магазинных.

Мастер-класс «Еловая шишка — новогодняя игрушка»

Мастер-класс

«Еловая шишка — новогодняя игрушка»

Булатова Татьяна Михайловна,

педагог дополнительного

образования

МБОУДО «Кедровский центр

развития творчества

детей и юношества»

г. Кемерово

Самое интересное и веселое занятие, это готовится к встрече Нового года. Шишки – это природный материал, из которого получаются очень красивые новогодние украшения. Сама шишка уже является ёлочным украшением, достаточно повесить её в первозданном виде на деревце. Но более сказочно они будут смотреться в «заснеженном» виде. На раскрытые чешуйки наносят клей ПВА и посыпают их мелкой солью, так же можно покрасить чешуйки белым акрилом. Развешивают разноцветные шишки, приделав к ним банты из атласной ленты контрастного цвета.

Материалы для работы: шишки еловые, ткань: органза, парча, вуаль, ленты атласные, сизаль, различные блестки, пайетки, фетр, игла, нитки, клей ПВА и ТИТАН, белый акрил.

Ход работы:

Из мешковины или фетра вырежьте круг по диаметру верхушки шишки, проденьте надежную нитку и сделайте петельку. Приклейте ткань с петелькой на верхушку шишки. Придерживайте пока приклеиться хорошо.

Нарежьте из красивой ткани любого цвета 2 полоски:

1. длиной 30 см. и шириной 4см.

2. длиной 30см. и шириной 3см.

При помощи иголки с ниткой соберите их по краю ткани в сборку, получатся две юбочки. Сильно не стягивайте, оставьте отверстие для того, чтобы продеть петельку. Ножницами по краю сделайте зубчики.

Нанесите клей ТИТАН на верхушку шишки и оденьте первую юбочку на шишку, продеваем петельку. Затем опять нанесите немного клея и оденьте вторую юбочку.

На верхушку шишки привяжите несколько нитей сизали, завяжите бант из атласной ленты, на нити сизали приклеиваем пайетки. Чешуйки шишки красим белым акрилом. После высыхания, наносим клей ПВА и на него сухой кистью посыпаем блестки. Можно в работе использовать соль. На раскрытые чешуйки наносят клей ПВА и посыпают их мелкой солью.

Настроение уже совсем предновогоднее. Такие украшения на елочке будут радовать все новогодние праздники.

мастер класс, фото, пошагово из листьев, осенний топиарий из желудей, как сделать из каштанов и сосны, новогодний из еловых шишек, видео

Топиарий из шишек – отличная поделка для выставки детского творчества в школу или детский сад, а главное – прекрасный повод вместе провести время интересно и с пользой

Еще осенью во время прогулок по парку или лесу не поленитесь набрать немного плодов природы, тех же листьев, рябины, желудей и, конечно, шишек. Какая поделка из всего этого может получиться, остается только фантазировать, но то, что творческому человеку весь этот нехитрый скарб понадобится, это точно. К примеру, из еловых шишек своими руками можно сделать удивительные вещи. Или не из еловых, а сосновых, а может быть, из самых маленьких, едва заметных шишечек вы решите сделать осенний или зимний сувенир?

Посмотрите, сколько примеров подобных работ в галерее фото – это и топиарий из сосновых шишек, и веночки на дверь из шишек, каштанов, листьев и желудей.

Содержание материала:

Топиарий с шишками: что подготовить

Для топиария с кроной из шишек вам понадобятся материалы и инструменты, которые найдутся практически в каждом доме. Но кое-что, возможно, придется подкупить.

Краска или искусственный снег из баллончика сделают внешний вид шишечного деревца торжественным

Материалы и инструменты:

  • Пластмассовая бутылка;
  • Бамбуковый коврик;
  • Цветная бумага;
  • Клей;
  • Мешковина;
  • Пенопластовый шарик;
  • Шишки;
  • Ветки;
  • Краска-спрей;
  • Лента.

Данный мастер-класс предполагает, что горшочек для деревца вы сделаете своими руками. Можно взять обычную бутылку от молока, обрезать в ней горлышко, сделать края ровными. По форме дна бутылки нужно сделать отрезок из цветной бумаги, приклеить ко дну горячим клеем.

Для топиария из шишек помимо основного материала, не забудьте подготовить декор

Дальнейший МК включает в себя следующие шаги:

  • Бамбуковый коврик нужен для того, чтобы окончательно задекорировать горшочек. Коврик обрезается так, чтобы он слегка выступал за края молочной бутылки. Коврик оборачивается вокруг отрезанной бутылки, приклеивается к ней. На примерах фото можно подробнее рассмотреть, какой декор получается с помощью бамбуковых ковриков.
  • Завершается декор горшочка приклеиванием мешковины и бантика. Отрезок мешковины должен так же быть обернутым вокруг вазончика, сначала приклеивается он, а сверху – тонкая атласная лента. Под ленту можно просунуть маленькую веточку рябины.
  • Далее вам понадобится пенопластовый шар. Этот момент стоит пояснить. Сегодня каждый второй мастер-класс предполагает использование именно такой заготовки, которая приобретается в магазинах рукоделия. Он служит твердой основной для формирования кроны. Но основу можно сделать и своими руками. От старого способа (комок газеты) до поиска такого же круглого небольшого предмета (резиновый детский мячик).
  • Сделайте в шарике отверстие, куда вставится ствол топиария из шишек. Это будут сложенные в один пучок ветки.

Для декора горшочка можно использовать как кашпо, так и любой упаковочный материал или одноразовую посуду

Красиво оформить горшочек можно при помощи обычной мешковины и атласной ленты

Этот момент тоже нужно рассмотреть более подробно. Обычно классический мастер-класс по изготовлению топиария предлагает взять палочки для суши, карандаши или проволоку как основу для ствола. Но данный МК говорит о том, что ветки в топиарии с шишками смотреться будут естественнее.

Топиарий из шишек: мастер-класс пошагово

После того, как у вас есть горшочек, пенопластовая основа и вставленный в нее ствол из веток, пора своими руками подготовить шишки. Идеально, если они небольшие по размеру и примерно одинаковые.

Можно найти отдельный мастер-класс о том, как задекорировать шишки. Способы самые разные. К примеру, можно покрыть их белой краской, затем, дождавшись высыхания, нанести ПВА-клей губкой, и сверху посыпать шишки морской солью. Получатся такие снежные шишечки.

Можно покрасить шишки спрей-краской. Какой цвет лучше взять, посмотрите на фото. Если это новогодний топиарий, уместны золотистые и серебристые краски.

Дерево счастья в эко стиле из шишек – целое поле для действий творческому человеку. При декорировании кроны можно придерживаться новогодней тематики или создать атмосферу осеннего леса

Возвращаясь к МК, действия будут следующими:

  • Шарик-крону на ветке вставьте в горшочек. Это может быть уже наполненный землей вазончик, или залитым свежим гипсом. Как хотите, но ствол из веток должен крепко сидеть в горшочке.
  • Сверху нужно украсить чем-то землю или гипс. Это может быть искусственная трава, если топиарий все-таки осенний. Туда же можно бросить парочку миниатюрных кленовых листьев. Подсмотреть идеи можно на фото.
  • Далее мастер-класс предписывает делать крону. А именно – приклеивать шишки. Элементы фиксируются термоклеем по кругу. Старайтесь, чтобы пустот не было, иначе их придется чем-то заполнять. Или же изначально покрасьте заготовку тем же серебристым аэрозолем.
  • Новогодний топиарий предполагает снежный декор. Вата, мишура, та же морская соль, фетровые снежинки, серебристые нити – своими руками можете сделать самый невероятный снежок. Или же взять для такого топиария из шишек искусственный снег.

Вместо искусственного снега можно использовать позолоту или другие аэрозольные краски

Следующие моменты мастер-класс предлагает на выбор. Топиарий с шишками может быть украшен бусинами, атласными ленточками, объемными снежинками, и даже елочными игрушками.

Новогодний топиарий из шишек (видео)

Новогодний топиарий из шишек

Новогодний топиарий может включать себя буквально все, что ассоциируется с праздником. Так, нередко декором к шишечному топиарию становятся мандарины. От этого деревце приобретает особый аромат, и на фото может убедиться – выглядит сувенир весьма празднично.

А как сделать топиарий из шишек еще ярче:

  • Пусть под деревцем «присядут» лесные зверушки, их тоже можете сделать своими руками, а можете и взять готовые фигурки.
  • Изящно будет смотреться топиарий из шишек и желудей абсолютно белый, либо белый с серебром.
  • Новогодний топиарий может стоять на салфетке-солнышке из ваших самых ярких фото за год. Возьмите двенадцать фото (по количеству месяцев), выложите их по принципу солнечных лучиков, а в центр поставьте топиарий. Целая композиция своими руками получилась!

В некоторых случаях можно обходиться и без шара для кроны: ее не сложно собрать из самих шишек

А еще рядом с таким топиарием запросто может оказаться не совсем уж миниатюрная белочка. Более того, такая белочка может даже будто бы держать своими руками горшочек с деревцем. Мило и уютно!

Осенняя поделка: топиарий из шишек и каштанов

Отдельный мастер-класс можно не изобретать. Действия будут похожими, ведь отличается работа разве что наличием этих самых каштанов. 

Украшение кроны топиария каштанами сделает вашу поделку более уместной для осеннего декора

А как можно добиться красивого декора каштанов:

  • Опять же, часто выручают аэрозольные краски. С позолотой и серебром – ваш случай.
  • Россыпь каштанов можно украсить точечной росписью. Той самой, что расписывают гладкие морские камушки. Смотрится весьма оригинально, на работа по такой росписи (не важно, камней или каштанов) практически ювелирная.
  • Можно просто выделить шапочки каштанов другим цветом.

У каштанов гладкая структура, постарайтесь ее подчеркнуть.

Топиарий из шишек “Зеленые хризантемы” (видео мастер-класс)

Нарядные деревца – топиарии красивы не только на фото. Они смотрятся празднично, изящно, аккуратно, от них веет чем-то добрым и сказочным. Попробуйте сделать такое сами, и вы об этом не пожалеете.

Удачной работы!

Топиарий из шишек (фото)

Как делать трендовые шишки из ткани и бумаги

Это новый дизайн елочных игрушек, захвативший весь Интернет. Подобные шишки из лент, ткани, бумаги и прочих уместных материалов даже успешно продаются официальными крупными компаниями (Wildberries) и на сайтах, где люди творческие и умелые имеют возможность торговать профессионально выполненными рукодельными вещами, игрушками и сувенирами.  

Ничего сложного в схеме создания шишек из ткани и бумаги нет – тем не менее, работа кропотливая и должна быть выполнена исключительно четко и аккуратно, чтобы результат радовал глаз. Второй главный момент в этой работе – тщательно подбирать материалы и их расцветки, особенно комбинировать последние, т. к. именно от этого зависит, насколько эффектной получится шишка.

Материал для работы подбираем плотный – и в отношении бумаги, и в отношении тканей – чтобы «чешуйки шишек» потом хорошо держали свою форму. Со скользкими тканями и лентами работать будет ощутимо сложнее (кусочки маленькие, а складывать их придется много), имейте это в виду, но результат из них получается самый красивый. Если работаете с тканью, обязательно подшивайте нижний длинный край каждой полоски (или хотя бы подгибайте и проглаживайте или фиксируйте клеем), прежде чем делать из них треугольники (все остальные края тканевых полосок подшивать не нужно).

Итак, пошаговая схема создания шишек из ткани и бумаги в картинках:

1. Нарезаем кусочки лент – примерно 2,5 см в длину. Ширина зависит от габаритов вашей шишки – чем больше шишка, тем шире берите ленты.

2. Покупаем или сами вырезаем из поролона/пенопласта/современного пеноматериала или даже шьем из ткани и набиваем любым подходящим материалом основы для шишек – в форме яиц. Вырезая, помните, что основы должны лишь иметь более-менее симметричную форму яйца, а не быть идеально ровными, что гораздо проще.

3. На верхушке зауженной/чуть заостренной части яйца ровно по центру фиксируем квадратик из ленты/бумаги/ткани первого цвета. На всех сайтах, предоставляющих схемы создания шишек из ткани и бумаги, это предлагается делать булавками с миниатюрными навершиями. Тем не менее, я вам этого делать крайне не рекомендую по той простой причине, что если основа шишки мягкая и на готовую шишку кто-то упадет или просто нечаянно сожмет ее в руках, забывшись, эти булавки, как еж, проткнут части тела, и, вероятно, очень глубоко.

Если основа из жесткого пенопласта – используйте булавки на свой страх и риск: что-то тяжелое, упав или с размаха, может сжать и пенопласт. Если нет – отдайте предпочтение клею для ткани или горячему клею, который не пропитывает ткань/ленты насквозь. И/или выбирайте подходящую для клея ткань.

4. Работаем снизу шишки и далее вверх рядами. Складываем из ленты/ткани нового цвета (если шишка у вас будет не однотонной) по очереди кусочки и крепим их вокруг уже зафиксированного на основе квадрата. Т. е. находим середину верхнего края первого кусочка с лицевой стороны и загибаем боковые края кусочка наизнанку так, чтобы найденная точка стала вершиной треугольника. Проглаживаем треугольник утюгом. Края ленты/полоски сзади треугольника фиксируем каплей клея или нитками. Клей высох – крепим первый треугольник швом к основе шишки и внахлест на уголок квадрата на яйце – крепим только за основание треугольника.

Или вот так с прямоугольником:

5. Следующие 3 треугольника также крепим на уголки квадрата – оставшиеся свободные, справа и слева тоже чуть заходя на края других треугольников.

Или кладем треугольники вот так — впритык друг к дуругу:

6. Делаем новый треугольник – из ленты/полоски того же цвета, что и квадрат, либо третьего цвета, если шишка не однотонная. Крепим его на яйцо-основу так, чтобы вершина нового треугольника легла ровно между двумя треугольниками нижнего ряда и внахлест примерно до середины длины одной боковой стороны уже закрепленного треугольника.

Или вот так:

7. То же самое повторяем с еще 3-мя новыми треугольниками.

8. Следующий ряд делаем из ленты того же цвета, треугольники опять крепим между предыдущими  — т. е. всегда в шахматном порядке, но теперь уже внахлест до середины высоты треугольника, находящегося через 1 ряд от нового.

9. Еще два ряда новым цветом – первым или вторым (из 4-х цветов шишки делать не стоит, они уже станут смотреться вульгарно), затем еще 2 ряда – опять чередуя цвета и так далее до самого верха.

10. Когда шишка начнет снова сужаться, просто делайте нахлест справа и слева по бокам треугольников сильнее. Сверху на шишку опять крепим квадрат ленты/ткани, но теперь уже обязательно с заранее подшитыми/приклеенными наизнанку осыпающимися краями.

11. Наконец, сверху клеим или фиксируем как-то иначе петлю, чтобы шишку можно было подвесить туда, куда вы захотите.

С бумагой работаем точно также, за исключением того, что с ней вам будет гораздо легче – и не придется нигде подшивать края полосок.

 

Вот здесь идет иная схема наложения чешуек, обратите внимание:

Наконец, можно сделать шишку и из фетра, скажем, но она будет выглядеть дешево. Можно делать шишки почти таким же образом из закругленных кусочков неосыпающейся плотной ткани или даже кружева, но понравится ли вам результат – судите сами:

Расцветку треугольников можно чередовать и просто в шахматном порядке – тоже смотрится прекрасно.

Кусочки ткани для треугольников можно нарезать так, чтобы внизу на каждом кусочке шла тонкая полоска другого цвета, тогда кончики треугольников станут очень эффектно выделяться.

Сверху шишки можно украсить искусственной сезонной зеленью и ягодами, бантами, колокольчиками и прочим тематическим декором. Можно также на кончики треугольников-чешуек пришить миниатюрные бусинки или бисер.

В том же формате даже делают колокольчики:

А это другие дизайны для вашего вдохновения:

Kvartira Hand made

В данном мастер-классе я расскажу как сделать вот такие новогодние украшения «Снежные шишки». Ими можно украсить елку или уголок с новогодней композицией в доме.




Для изготовления таких шишек нам понадобиться:
1. конечно же, сами шишки
2. соль обычная пищевая
3. белая акриловая краска в аэрозоли

4. лак для волос сильной фиксации
5. клей-карандаш (или ПВА)
6. клей момент (или горячий клей)
7. ленты для украшения на ваш вкус
Приступим. В тарелку насыпаем немного соли. Шишку слегка промазываем клеем (клей должен быть только на кончиках), я использую клей-карандаш, можно заменить на ПВА. Затем обваливаем шишку в приготовленной соли.






















На наших шишках уже появился «снежок». Далее нам нужно придать шишкам законченный декоративный вид. Для этого добавим белый налет с помощью белой краски в аэрозоли.

На ровную поверхность раскладываем наши шишки (предварительно постелив ненужную клеенку или пакет). Наносим аэрозольную краску. 

Просушиваем, переворачиваем шишки и таким образом красим их со всех сторон.



Получаем вот такую красоту! Чтобы соль почти не осыпалась, закрепляем все обычным лаком для волос.
Затем украсим шишки лентами. Делаем бантики из лент. 



Приклеиваем бантики к основанию шишки. Если вы планируете использовать шишки как елочные игрушки, то необходимо еще приклеить петлю  для подвешивания на елку. Ее можно сделать из тоненьких лент или из шнура. Я взяла серебряный шнур. Клеить удобнее всего на горячий клей, но можно и на момент.



Ну вот и все, наши шишки готовы!

И еще немного фото того, что у меня получилось:





Попурри Праздничное попурри в большой декоративной стеклянной банке с бантом из красной зеленой шотландской ленты Зимние специи Корица Сосна Рождественская смесь ароматов с сосновыми шишками Отличный рождественский подарок

Праздничное попурри в большой декоративной стеклянной банке с красно-зеленым бантом из ленты в шотландскую клетку Зимние специи Сосна с корицей Рождественская смесь ароматов с сосновыми шишками Отличный рождественский подарок

5 см х 12 см после заполнения и весит примерно 550 г. Каждая из этих потрясающих стеклянных банок наполнена праздничной смесью сосновых шишек. Каждая из этих потрясающих стеклянных банок наполнена праздничной смесью сосновых шишек. Попурри Праздничное попурри в большом декоративном стакане Баночка с красной зеленой тартановой лентой с бантом Зимняя специя Корица Сосновый рождественский аромат Смесь с сосновыми шишками Отличный рождественский подарок, аромат сосны с корицей, идеально подходит для столов, купить праздничное попурри в большой декоративной стеклянной банке с красно-зеленым тартановым бантом из ленты Зимняя специя Рождественский аромат с корицей и сосной Смесь с сосновыми шишками Отличный рождественский подарок в Великобритании, Праздничное попурри в большой декоративной стеклянной банке с красно-зеленым бантом из тартановой ленты Зимние специи Рождественский аромат сосны с корицей Смесь с сосновыми шишками Отличный рождественский подарок: Кухня и дом, Аромат сосны и корицы, Каждая банка имеет размеры прибл. , Насыщенные праздничные ароматы, Праздничное попурри в большой декоративной стеклянной банке с бантом из красной зеленой тартановой ленты Зимняя специя Сосна с корицей Рождественский фрагмент rance Смесь с сосновыми шишками Отличный рождественский подарок

Стеклянная банка с рождественским попурри, Стеклянная банка с рождественским попурри, центральными предметами и вазами, Наполните свой дом роскошными рождественскими ароматами этой зимой, Наполните свой дом роскошными рождественскими ароматами этой зимой, Попурри Праздничное попурри в большой декоративной стеклянной банке с красно-зеленой клетчатой ​​лентой Рождественская смесь ароматов Bow Winter Spice Cinnamon Pine с сосновыми шишками Отличный рождественский подарок, центральные украшения и вазы, Бесплатная доставка и возврат при соответствующих заказах, Potpourri Праздничное Potpourri в большой декоративной стеклянной банке с красной зеленой лентой Tartan Bow Winter Spice Cinnamon Pine Christmas Смесь ароматов с Сосновые шишки Отличный рождественский подарок, 5 см х см после заполнения и весит около 550 г, Идеально подходит для столов, Насыщенные праздничные ароматы, 12 см х 16, Размеры каждой баночки прибл., см х 6





рыбок данио Cacna1fa необходимы для функции фоторецепторов колбочек и формирования синаптических лент | Молекулярная генетика человека

Аннотация

Мутации в гене CACNA1F человека вызывают неполную врожденную стационарную куриную слепоту 2 типа (CSNB2), непрогрессирующее, клинически гетерогенное заболевание сетчатки.Однако молекулярные механизмы, лежащие в основе CSNB2, до конца не изучены. Здесь мы описываем позиционное клонирование слепого мутанта рыбки данио, ждать до наступления темноты ( wud ), который кодирует гомолог CACNA1F человека у рыбок данио. Мы идентифицировали двух паралогов cacna1f рыбок данио

и показали, что транскрипт cacna1fa (ген, мутировавший в wud ) экспрессируется исключительно в слое фоторецепторов. Мы продемонстрировали, что Cacna1fa локализуется в синапсах фоторецепторов и отсутствует у мутантов wud .Электроретинограммы выявили аномальные реакции фоторецепторов колбочек у мутантов wud , что указывает на дефект синаптической передачи. Хотя очевидных морфологических различий нет, мы обнаружили, что мутанты wud лишены синаптических лент и что wud необходим для развития синаптических лент. Мы обнаружили, что Ribeye, наиболее известный белок синаптической ленты, был менее распространен и неправильно локализован у взрослых мутантов wud . Помимо клонирования wud , мы идентифицировали synaptojanin 1 ( synj1 ) как дефектный ген у slacker ( slak ), слепого мутанта с плавающими синаптическими лентами.Мы определили, что Cacna1fa экспрессировался в
фоторецепторах slak
и что Synj1 изначально экспрессировался в фоторецепторах wud , но отсутствовал через 5 дней после оплодотворения. В совокупности наши данные демонстрируют, что Cacna1fa необходим для функции фоторецепторов колбочек и формирования синаптических лент, и раскрывают ранее неизвестную, но критическую роль потенциал-зависимых кальциевых каналов L-типа в экспрессии и/или распределении белков синаптических лент, обеспечивая новую модель для изучения клинической изменчивости у пациентов с CSNB2.

ВВЕДЕНИЕ

Фоторецепторные клетки обладают удивительной способностью реагировать и адаптироваться к широкому диапазону интенсивности света (1). Для передачи этой динамической визуальной информации их пресинаптические окончания образуют специализированные структуры, называемые синаптической лентой, которые присутствуют в фоторецепторных клетках палочек и колбочек сетчатки, биполярных клетках и сенсорных волосковых клетках внутреннего уха (2). Хотя было предложено несколько ролей, широко распространено мнение, что ленты функционируют как молекулярные конвейерные ленты для синаптических пузырьков и тонического высвобождения нейротрансмиттера глутамата (3–6).За последние годы был достигнут большой прогресс в идентификации многих ключевых компонентов, необходимых для синаптической ленточной структуры (3,7,8). Например, направленная делеция мышиного гомолога белка синаптической ленты BASSOON приводит к незакрепленным «плавающим» лентам и нарушению синаптической передачи (9). Мутации

synaptojanin1 у рыбок данио также вызывают плавающие ленты из-за его роли в закреплении ленты (10-13). Кроме того, морфолино-нокдаун рыбок данио ribeye a приводит к укорочению и меньшему количеству синаптических лент (14).Хотя наше понимание синаптических лент расширилось, многое остается неизвестным в отношении сложных взаимодействий между этими белками и того, как они влияют на синаптогенез лент.

Фоторецепторные потенциалзависимые кальциевые каналы L-типа (L-VDCC) находятся рядом с синаптическими лентами и необходимы для притока кальция и слияния синаптических пузырьков (4,15). Существенная роль этих каналов для зрительной функции очевидна при Х-сцепленном заболевании сетчатки человека врожденной стационарной ночной слепоте 2 типа (CSNB2), где десятки мутаций были идентифицированы в гене CACNA1F (16–18).Электроретинограммы (ERG) у этих пациентов показывают, что синапсическая передача от фоторецепторов палочек снижена, а функция фоторецепторов колбочек нарушена (19). Мышиная модель nob2 ( no b-волна 2 ) также приводит к аномальной синаптической передаче и глубокой потере синапсов палочек-фоторецепторов (20), хотя недавние исследования показали, что nob2 не является полным нокаутом Cacna1f. (21).

В отличие от nob2 , полный нокаут мышиного Cacna1f приводит к дегенерации колбочковых фоторецепторов, фенотип, не обнаруживаемый у пациентов с CSNB2 у людей.Т.о., из-за потери колбочек при полном нокауте у мышей мало что известно о функции L-VDCCs в ленточных синапсах фоторецепторов колбочек.

Здесь мы сообщаем, что слепой мутант рыбки данио ждет до наступления темноты ( wud ) кодирует гомолог человеческого CACNA1F и что мутант slak кодирует Synaptojanin 1 (Synj1). Наши результаты показывают, что рыбка данио cacna1fa необходима для правильного формирования синаптической ленты и функции колбочкового фоторецептора из-за важной роли в регуляции экспрессии и локализации белков синаптической ленты.Мы предполагаем, что наша модель рыбок данио представляет собой новый инструмент для изучения L-VDCCs в фоторецепторах колбочек, который может улучшить наше понимание клинической изменчивости у пациентов с CSNB2.

РЕЗУЛЬТАТЫ

wud имеет более тонкий внешний плексиформный слой и дефектные ERG

wud был идентифицирован в крупномасштабном мутагенезном скрининге дефектов зрительного поведения, где были выделены пять аллелей wud (22).Мутанты wud показали нормальную внешнюю морфологию, адаптацию зрительного фона и спонтанную плавательную активность, но полностью отсутствовали оптокинетический ответ (OKR) и оптомоторный ответ (OMR), что указывает на то, что мутанты wud были слепыми. Как рецессивная мутация, wud следует менделевскому наследованию; где четверть потомков от гетерозиготных родителей являются отрицательными по OKR и OMR. Несмотря на потерю зрения, мутанты wud жизнеспособны во взрослом состоянии, что указывает на то, что ген wud необходим не для выживания, а для зрительной функции.В поведении взрослые мутанты wud слепы при ярком и тусклом свете, что указывает на нарушение функции как колбочек, так и палочек (данные не показаны). Они не проявляют реакции испуга и обычно остаются у дна своего аквариума, где они кормятся осевшей пищей, и не едят, следуя визуальным сигналам, поведение, которое ясно видно у взрослых особей дикого типа. Поскольку зрительная система личинок рыбок данио моложе 15 дней после оплодотворения (dpf) полностью зависит от колбочек, а не палочек (23), мутация wud , по-видимому, влияет на функцию фоторецепторов колбочек и/или обработку сигналов фоторецепторов колбочек.

Чтобы изучить морфологию сетчатки, мы провели иммуногистохимию (ИГХ) с антителами zpr1 и PKC, которые метят колбочковые фоторецепторные клетки и биполярные клетки соответственно. Этот анализ не выявил существенных различий между диким типом и wud (рис. 1A–F). Однако мы отметили, что внешний плексиформный слой (OPL) оказался тоньше у wud по сравнению с братьями и сестрами дикого типа. OPL — это первый синаптический слой сетчатки, где фоторецепторы соединяются с дендритами биполярных и горизонтальных клеток, образуя уникальную нейросенсорную структуру, называемую ленточным синапсом (1,4).Чтобы изучить OPL более внимательно, мы измерили толщину OPL у личинок дикого типа и мутантов. Как показано на рисунке 1G–J, OPL был значительно тоньше у wud (2,12 мкм ± 0,18, n = 26) по сравнению с диким типом (3,54 мкм ± 0,12, n = 24) (рис. 1K). . Это привело нас к заключению, что ген wud может кодировать белок, локализующийся в синапсах фоторецепторов колбочек.

Рисунок 1. Мутанты

wud имеют более тонкий внешний плексиформный слой.( A – F ) IHC выявил относительно нормальную морфологию сетчатки. Личинки на 7 дпф были окрашены zpr1 (A и D), который маркирует двойные колбочки, и PKC (B и E), который маркирует биполярные клетки. Ядра были контрастно окрашены DAPI на объединенных изображениях (C и F). ( G K ) Мутанты wud имеют более тонкий внешний плексиформный (OPL) слой. Здесь показаны окрашенные H&E полутонкие пластиковые срезы личинок дикого типа (G) и wud (I) на 7 dpf. Увеличенные изображения выделенных областей на G и I показаны на H и J соответственно.Измерения ( n = 24 на группу) выявили значительно более тонкий OPL (K, P <0,0001). ONL, внешний ядерный слой; OPL, внешний плексиформный слой; INL, внутренний ядерный слой; IPL, внутренний плексиформный слой; Л, линза; НА, зрительный нерв. Шкала баров для C, F и H составляет 10 мкм, а G составляет 20 мкм.

Рисунок 1. Мутанты

wud имеют более тонкий внешний плексиформный слой. ( A – F ) IHC выявил относительно нормальную морфологию сетчатки. Личинки на 7 дпф были окрашены zpr1 (A и D), который маркирует двойные колбочки, и PKC (B и E), который маркирует биполярные клетки.Ядра были контрастно окрашены DAPI на объединенных изображениях (C и F). ( G K ) Мутанты wud имеют более тонкий внешний плексиформный (OPL) слой. Здесь показаны окрашенные H&E полутонкие пластиковые срезы личинок дикого типа (G) и wud (I) на 7 dpf. Увеличенные изображения выделенных областей на G и I показаны на H и J соответственно. Измерения ( n = 24 на группу) выявили значительно более тонкий OPL (K, P <0,0001). ONL, внешний ядерный слой; OPL, внешний плексиформный слой; INL, внутренний ядерный слой; IPL, внутренний плексиформный слой; Л, линза; НА, зрительный нерв.Шкала баров для C, F и H составляет 10 мкм, а G составляет 20 мкм.

Для изучения физиологии внешней части сетчатки мы выполнили ЭРГ. ЭРГ обычно используются в качестве индикатора функции внешней сетчатки и состоят из небольшой отрицательной волны а, возникающей от фоторецепторов, и большой положительной волны b, возникающей из-за деполяризующих ON биполярных клеток. Для этих экспериментов мы зарегистрировали от адаптированных к темноте личинок дикого типа и личинок wud при 5–6 dpf в ответ на 20-мс вспышку белого света.Как показано на рисунке 2, личинки дикого типа демонстрируют стереотипные реакции, амплитуда которых увеличивается при более ярком свете. Напротив, wud показали, что аномальные ЭРГ включают небольшую а-волну, за которой следует задержанная и редуцированная b-волна, согласующаяся с дефектом синаптической передачи от колбочковых фоторецепторов. Неожиданно мы также обнаружили дополнительный медленный положительный компонент ЭРГ wud , который увеличивался с интенсивностью света. Применение аналога глутамата APB, который блокирует синаптическую передачу фоторецепторов (24), не влияло на этот положительный компонент (данные не показаны), указывая на то, что этот ответ, вероятно, возникает из-за дефектных фоторецепторов колбочек, а не биполярных клеток.Чтобы продемонстрировать, что это не было электрическим артефактом, мы зарегистрировали у рыбок данио pde6c w59 мутант, который имеет мутацию в гене специфичной для колбочек фосфодиэстеразы 6c (25). Как и ожидалось, эти записи показали плоские следы, соответствующие дефектам фототрансдукции и дегенерации фоторецепторов у мутанта pde6c w59 . Таким образом, наши результаты показывают, что wud имеет дефектную ЭРГ, указывающую на дефект синаптической передачи, а также дополнительные аномалии.

Рисунок 2. Мутанты

wud демонстрируют аномальные ЭРГ. Личинки дикого типа демонстрировали стереотипные ЭРГ при 4 логарифмических единицах освещения (интенсивность вспышки показана справа). Компоненты а- и b-волн ЭРГ показаны на самой тусклой кривой (внизу слева). Мутанты wud показали дефектные ERG со значительно сниженной чувствительностью. Эти формы волны включают маленькую волну a, за которой следует задержанная и редуцированная волна b, и медленный крупный положительный компонент, который может представлять волну c, указанную на верхней кривой wud .От мутантов pde6c не было зарегистрировано никаких ответов ЭРГ, хотя на самой яркой кривой (верхняя, правая кривая) можно увидеть крошечный артефакт вспышки. Крупные планы выделенных рамкой областей из второй кривой дикого типа и wud показаны внизу, чтобы проиллюстрировать величину а-волны и задержку b-волны.

Рисунок 2. Мутанты

wud демонстрируют аномальные ЭРГ. Личинки дикого типа демонстрировали стереотипные ЭРГ при 4 логарифмических единицах освещения (интенсивность вспышки показана справа).Компоненты а- и b-волн ЭРГ показаны на самой тусклой кривой (внизу слева). Мутанты wud показали дефектные ERG со значительно сниженной чувствительностью. Эти формы волны включают маленькую волну a, за которой следует задержанная и редуцированная волна b, и медленный крупный положительный компонент, который может представлять волну c, указанную на верхней кривой wud . От мутантов pde6c не было зарегистрировано никаких ответов ЭРГ, хотя на самой яркой кривой (верхняя, правая кривая) можно увидеть крошечный артефакт вспышки.Крупные планы выделенных рамкой областей из второй кривой дикого типа и wud показаны внизу, чтобы проиллюстрировать величину а-волны и задержку b-волны.

вуд кодирует Cacna1fa

Для идентификации дефектного гена в wud мы использовали стратегию позиционного клонирования. wud первоначально картировали в группе сцепления (LG) 8 с использованием микросателлитных маркеров (22). Точное картирование с помощью рекомбинационного анализа определило критический интервал 4.7 Мб между маркерами z789 и z15786, охватывающими около 75 известных и 13 новых генов при изучении генома рыбки данио на веб-сайте ensembl.org (рис. 3A). Анализ базы данных в этом регионе идентифицировал ген рыбки данио с сильной гомологией с человеческим CACNA1F . Поскольку мутации в CACNA1F вызывают заболевание сетчатки у человека, мы рассмотрели этого ортолога рыбок данио как сильного кандидата на ген wud . В соответствии с событием дупликации всего генома у рыбок данио, мы идентифицировали два паралога человеческого CACNA1F , которые мы назвали cacna1fa (ген wud ) и cacna1fb (~ 23 Мб проксимальнее локуса wud ).Выравнивание последовательностей предсказанных белков показало, что Cacna1fa рыбок данио (также называемый Ca v 1.4a, кодируемый cacna1fa ) и Cacna1fb (кодируемый cacna1fb ) на 62,8% и 55,5% идентичны человеческому Ca , , , соответственно. Открытая рамка считывания транскрипта cacna1fa содержит 6345 п.н., которые кодируют белок из 2115 аминокислот с предполагаемой молекулярной массой 232 кДа и белковые домены, очень похожие на домены Ca v 1 других позвоночных.4 белка (рис. 3B). Секвенировав кДНК cacna1fa , мы обнаружили трансверсионную мутацию 626T>A в аллеле wud s129 и переходную мутацию 3403C>T в wud s315 аллелях и аллелях L2 стоп кодона1, Q39X1, Q39X1, соответственно (рис. 3B). Никаких мутаций не было обнаружено в cacna1fb или любых других исследованных генах-кандидатах.

Рисунок 3.

wud кодирует Cacna1fa и экспрессируется в фоторецепторах колбочек.( A ) Генетическая карта локуса wud на рыбке данио LG 8 с указанием генетических маркеров и соседних генов. ( B ) Схема белка Cacna1fa рыбки данио, показывающая расположение мутаций wud . Канал содержит четыре повторяющихся домена, каждый из которых содержит каждые шесть трансмембранных областей, альфа-взаимодействующий домен (AID), домен IQ и домен PDZ на С-конце. Примерное положение эпитопа антитела отмечено звездочкой.Два независимых аллеля wud (s129 и s315) были секвенированы, и было обнаружено, что оба имеют преждевременные стоп-кодоны, которые, по прогнозам, приводят к нулевым мутациям. ( C – F ) WISH cacna1fa (C и D) и cacna1fb (E и F) при 3 днях в день показали экспрессию в слое фоторецепторов и во внутренней части сетчатки, соответственно. (C) и (E) показывают целые препараты, а (D) и (F) показывают криосрезы сетчатки (C) и (E) соответственно. Масштабная линейка: (B), 50 мкм.

Рисунок 3.

wud кодирует Cacna1fa и экспрессируется в фоторецепторах колбочек.( A ) Генетическая карта локуса wud на рыбке данио LG 8 с указанием генетических маркеров и соседних генов. ( B ) Схема белка Cacna1fa рыбки данио, показывающая расположение мутаций wud . Канал содержит четыре повторяющихся домена, каждый из которых содержит каждые шесть трансмембранных областей, альфа-взаимодействующий домен (AID), домен IQ и домен PDZ на С-конце. Примерное положение эпитопа антитела отмечено звездочкой.Два независимых аллеля wud (s129 и s315) были секвенированы, и было обнаружено, что оба имеют преждевременные стоп-кодоны, которые, по прогнозам, приводят к нулевым мутациям. ( C – F ) WISH cacna1fa (C и D) и cacna1fb (E и F) при 3 днях в день показали экспрессию в слое фоторецепторов и во внутренней части сетчатки, соответственно. (C) и (E) показывают целые препараты, а (D) и (F) показывают криосрезы сетчатки (C) и (E) соответственно. Масштабная линейка: (B), 50 мкм.

Чтобы изучить характер экспрессии генов данио cacna1f , мы провели полную гибридизацию in situ (WISH) на личинках дикого типа.Поскольку сетчатка рыбок данио становится функциональной через 3 dpf, мы исследовали экспрессию транскриптов cacna1f на этой стадии. Как показано на Фигуре 3, как cacna1fa , так и cacna1fb экспрессировались на высоких уровнях в сетчатке с незначительной экспрессией или без экспрессии вне глаза. Эти транскрипты экспрессировались во взаимоисключающих паттернах. Экспрессия cacna1fa была ограничена наружной частью сетчатки по схеме, соответствующей экспрессии фоторецепторов (фиг.3C и D), тогда как экспрессия cacna1fb была локализована во внутренней части сетчатки (рис. 3E и F). Учитывая преобладание колбочек в сетчатке личинок рыбок данио и дивергентный паттерн экспрессии дуплицированных генов cacna1f , мутант wud представляет собой уникальный инструмент для изучения потери функции cacna1fa конкретно в фоторецепторах колбочек.

Чтобы изучить экспрессию белка Cacna1f, мы создали поликлональное антитело против С-концевого фрагмента Cacna1fa (рис.3Б). Используя ИГХ, мы обнаружили Cacna1fa конкретно в OPL личинок дикого типа через 7 дпф. Этот образец окрашивания согласуется с нашими результатами WISH (рис. 3C и D) и подтверждает, что Cacna1fa экспрессируется только в OPL, а не в нескольких слоях сетчатки, как у млекопитающих (18). Как и ожидалось, мы не обнаружили Cacna1fa ни в одном из аллелей wud , что согласуется с обоими мутантами как с нулевыми аллелями, которые не экспрессируют функциональный белок Cacna1fa (рис. 4A). Однако, поскольку наше антитело было сконструировано вблизи С-конца, мы не можем исключить возможность того, что у мутантов экспрессируется укороченный белок.Поскольку между двумя аллелями wud не наблюдалось различий в зрительном поведении, экспрессии белка, морфологии или физиологии, последующие эксперименты были выполнены с wud s129 . Затем мы исследовали Cacna1fa у взрослых рыбок данио с помощью IHC. Как и в случае ИГХ личинок, мы обнаружили сильный сигнал в OPL взрослых особей дикого типа, но не обнаружили сигнала в OPL мутантов wud (рис. 4B). Чтобы продемонстрировать специфичность нашего антитела Cacna1fa, мы провели вестерн-блоттинг экстрактов глаз дикого типа и wud взрослых.Мы наблюдали единственную полосу при ~232 кДа в экстракте дикого типа и не обнаруживали полосу в экстракте мутанта wud (рис. 4C). Специфичность этого антитела была дополнительно подтверждена экспериментами по конкуренции антигенов (данные не показаны).

Рисунок 4.

Cacna1fa экспрессируется в OPL дикого типа и отсутствует в мутантах wud . ( A ) Cacna1fa был обнаружен специфически в OPL сетчатки дикого типа (WT) (7 dpf). Cacnaf1a не был обнаружен ни в wud s129 , ни в wud s315 .( B ) Cacna1fa локализуется на синаптических окончаниях фоторецепторов в сетчатке взрослых особей дикого типа. ( C ) Иммуноблот-анализ Cacna1fa (красный) из экстрактов глаз взрослых особей дикого типа и wud s129 мутантов. Актин (зеленый) использовали в качестве внутреннего эталона для загрузки геля.

Рисунок 4.

Cacna1fa экспрессируется в OPL дикого типа и отсутствует в мутантах wud . ( A ) Cacna1fa был обнаружен специфически в OPL сетчатки дикого типа (WT) (7 dpf).Cacnaf1a не был обнаружен ни в wud s129 , ни в wud s315 . ( B ) Cacna1fa локализуется на синаптических окончаниях фоторецепторов в сетчатке взрослых особей дикого типа. ( C ) Иммуноблот-анализ Cacna1fa (красный) из экстрактов глаз взрослых особей дикого типа и wud s129 мутантов. Актин (зеленый) использовали в качестве внутреннего эталона для загрузки геля.

Cacna1fa требуется для развития синаптических лент колбочек

Хотя известно, что мутации в мышином гене Cacna1f приводят к аномальным синапсам фоторецепторов палочек (26,27), мало что известно о структурных дефектах колбочек.Поэтому мы проанализировали ультраструктуру синапсов колбочковых фоторецепторов у мутантов wud с помощью просвечивающей электронной микроскопии (ПЭМ). У взрослых особей дикого типа мы наблюдали нормальные ножки колбочек с инвагинирующими дендритами из предполагаемых биполярных и горизонтальных клеток, а также стереотипные синаптические ленты, прикрепленные к пресинаптической мембране и выступающие перпендикулярно к концу колбочки (рис. 5А и В). Напротив, ножки колбочек у взрослых wud демонстрировали небольшую дендритную инвагинацию или полное отсутствие синаптических лент (рис.5С и D). Эти результаты согласуются с предыдущими исследованиями, демонстрирующими потерю синаптических лент палочек у мышей с нокаутом Cacna1f (26,27). Однако мы заметили мелкие частицы в ножке шишки wud , отсутствующие у дикого типа, которые напоминали маленькие круглые тела-предшественники (srPBs) (10).

Рисунок 5.

Синаптические ленты отсутствуют у мутантов wud . ( AD ) Трансмиссионная электронная микроскопия взрослых особей дикого типа и мутантов wud .У дикого типа (WT) в ножках колбочек обнаружены дендритные инвагинации и множественные состыкованные синаптические ленты (А и В). На (В) указаны горизонтальные клетки (звездочки) и синаптические ленты (стрелки). Напротив, мутанты wud имели аномальные ножки колбочек, в которых отсутствовали инвагинации дендритов и синаптические ленты (C и D). srPB наблюдались у мутантов wud (стрелки на D). Масштабная линейка: (А) и (С), 2 мкм; (Б) и (Г), 500 нм.

Рисунок 5.

Синаптические ленты отсутствуют у мутантов wud .( AD ) Трансмиссионная электронная микроскопия взрослых особей дикого типа и мутантов wud . У дикого типа (WT) в ножках колбочек обнаружены дендритные инвагинации и множественные состыкованные синаптические ленты (А и В). На (В) указаны горизонтальные клетки (звездочки) и синаптические ленты (стрелки). Напротив, мутанты wud имели аномальные ножки колбочек, в которых отсутствовали инвагинации дендритов и синаптические ленты (C и D). srPB наблюдались у мутантов wud (стрелки на D).Масштабная линейка: (А) и (С), 2 мкм; (Б) и (Г), 500 нм.

Поскольку в фоторецепторах колбочек wud с помощью ПЭМ не было обнаружено синаптических лент, мы исследовали экспрессию Ribeye, основного компонента синаптических лент и единственного известного белка, уникального для этой структуры (28). В дополнение к его структурной роли было высказано предположение, что рибай необходим для формирования синаптических лент (29,30). Подобно cacna1f , рыбки данио имеют два гена ribeye , оба из которых экспрессируются в сетчатке, а ген ribeye b экспрессируется специфически в фоторецепторах (14).Используя антитело, специфичное к Ribeye b (31), мы обнаружили, что Ribeye b специфически экспрессируется в OPL взрослых особей дикого типа и локализуется совместно с белком синаптических везикул SV2 (рис. 6A–D). Напротив, экспрессия Ribeye b была значительно снижена в OPL wud , показала небольшую колокализацию с SV2 и, по-видимому, была неправильно локализована во внутренних сегментах фоторецепторов (рис. 6E-H). Мы не обнаружили существенной разницы в уровнях мРНК ribeye b между диким типом и wud , как определено количественной ОТ-ПЦР (рис.6И). Наши данные указывают на роль Cacna1fa в экспрессии и локализации Ribeye b, которая, по-видимому, не зависит от регуляции транскрипции.

Рисунок 6.

Рибай b уменьшен и неправильно локализован у мутантов wud . ( A–H ) ИГХ проводили на 3-месячных сетчатках дикого типа и wud мутантных сетчатках. Здесь показано окрашивание дикого типа (A-D) и мутанта wud (E-H) с помощью Ribeye b (зеленый), SV2 (красный) и DAPI (синий). Крупные планы показаны для отдельных каналов для Ribeye b (B, дикий тип; F, wud ), SV2 (C, дикий тип; G, wud ) и наложения с DAPI (D, дикий тип; Н, вуд ).(I) Количественная ОТ-ПЦР показала, что экспрессия мРНК рибайя b была нормальной в сетчатке глаза по сравнению с братьями и сестрами дикого типа. Столбики погрешностей представляют собой стандартную ошибку среднего. Масштабная линейка: (А) и (Е), 100 мкм; (B) и (F), 10 мкм.

Рисунок 6.

Рибай b уменьшен и неправильно локализован у мутантов wud . ( A–H ) ИГХ проводили на 3-месячных сетчатках дикого типа и wud мутантных сетчатках. Здесь показано окрашивание дикого типа (A-D) и мутанта wud (E-H) с помощью Ribeye b (зеленый), SV2 (красный) и DAPI (синий).Крупные планы показаны для отдельных каналов для Ribeye b (B, дикий тип; F, wud ), SV2 (C, дикий тип; G, wud ) и наложения с DAPI (D, дикий тип; Н, вуд ). (I) Количественная ОТ-ПЦР показала, что экспрессия мРНК рибайя b была нормальной в сетчатке глаза по сравнению с братьями и сестрами дикого типа. Столбики погрешностей представляют собой стандартную ошибку среднего. Масштабная линейка: (А) и (Е), 100 мкм; (B) и (F), 10 мкм.

Чтобы выяснить, является ли взрослый синаптический фенотип в wud онтогенетическим или дегенеративным процессом, мы исследовали начальное формирование синаптических лент колбочек.Мы предсказали, что если бы Cacna1fa был необходим для начальных стадий развития лент, то мутанты wud никогда бы не образовали лент. Альтернативно, если бы Cacna1fa не была необходима для развития лент, тогда мы ожидали бы наблюдать начальное образование лент с последующей дегенерацией/разборкой, что указывает на то, что Cacna1fa играет роль в поддержании лент, а не в формировании. Предыдущие исследования на рыбках данио показали, что функциональные ленты возникают внутри синаптических окончаний фоторецепторов колбочек через 65 ч после оплодотворения (hpf) (10).Поэтому мы исследовали личинок дикого типа и мутантных личинок непосредственно до и после этой вехи развития. Как и ожидалось, у дикого типа или мутанта не наблюдалось никаких лент через 60 часов после оплодотворения (рис. 7A–D), однако в ножке дикого типа наблюдались инвагинированные отростки (рис. 7B). Однако через 72 часа после оплодотворения синаптические ленты явно присутствовали у личинок дикого типа ( n = 3), но отсутствовали у мутантов wud ( n = 5) (рис. 7E–H), что указывает на то, что Cacna1fa необходим для начального образования синаптических лент.Мы не обнаружили каких-либо доказательств отсроченного образования ленты в более поздний момент времени развития (рис. 7I-L), что еще раз подтверждает важную роль Cacna1fa в развитии синаптической ленты.

Рисунок 7.

Формирование синаптической ленты колбочек дефектно у мутантов wud . Трансмиссионная электронная микроскопия личинок дикого типа и мутантных личинок wud во время развития синаптической ленты. ( AD ) Через 60 часов после оплодотворения синаптические ленты не наблюдались у мутантов дикого типа или wud .Эмбрионы дикого типа показали ранние стадии инвагинации дендритов в ножки колбочек (звездочки) (B), которые отсутствовали в ножках колбочек мутантов wud (D). Через 72 часа после оплодотворения эмбрионы дикого типа показали нормальные ножки колбочек, содержащие синаптические ленты (E и F). Мутанты wud имели аномальные ножки колбочек и не имели синаптических лент ( G и H ), что указывает на дефект в начальном формировании синаптических лент. Через 7 дней в секунду результаты были аналогичны результатам через 72 часа после оплодотворения, когда у личинок дикого типа были нормальные ножки колбочек и синаптические ленты ( I и J ), а у мутантов wud отсутствовали синаптические ленты ( K и L ). ).Стрелки в (F) и (J) указывают на синаптические ленты. hpf, часы после оплодотворения; dpf, дни после оплодотворения. Масштабная линейка: (A), (C), (E), (G), (I) и (K), 2 мкм; (B), (D), (F), (H), (J) и (L), 500 нм.

Рисунок 7.

Формирование синаптической ленты колбочек дефектно у мутантов wud . Трансмиссионная электронная микроскопия личинок дикого типа и мутантных личинок wud во время развития синаптической ленты. ( AD ) Через 60 часов после оплодотворения синаптические ленты не наблюдались у мутантов дикого типа или wud .Эмбрионы дикого типа показали ранние стадии инвагинации дендритов в ножки колбочек (звездочки) (B), которые отсутствовали в ножках колбочек мутантов wud (D). Через 72 часа после оплодотворения эмбрионы дикого типа показали нормальные ножки колбочек, содержащие синаптические ленты (E и F). Мутанты wud имели аномальные ножки колбочек и не имели синаптических лент ( G и H ), что указывает на дефект в начальном формировании синаптических лент. Через 7 дней в секунду результаты были аналогичны результатам через 72 часа после оплодотворения, когда у личинок дикого типа были нормальные ножки колбочек и синаптические ленты ( I и J ), а у мутантов wud отсутствовали синаптические ленты ( K и L ). ).Стрелки в (F) и (J) указывают на синаптические ленты. hpf, часы после оплодотворения; dpf, дни после оплодотворения. Масштабная линейка: (A), (C), (E), (G), (I) и (K), 2 мкм; (B), (D), (F), (H), (J) и (L), 500 нм.

Приток кальция через кальциевые каналы инициирует множество различных клеточных процессов (32). Фактически было показано, что Ca v 1.3 регулирует размер синаптических лент в сенсорных волосковых клетках и шишковидной железе (33). Чтобы дополнительно изучить роль притока кальция в экспрессию ленточных белков фоторецепторов, мы обработали личинок дикого типа исрадипином, антагонистом кальциевых каналов L-типа, и исследовали экспрессию Ribeye b.Предыдущие исследования показали, что синаптические ленты являются очень динамичными органеллами, где у рыб синаптические ленты формируются днем ​​и распадаются ночью (10,34). Таким образом, для этого эксперимента личинки дикого типа были адаптированы к темноте для дезагрегации синаптических лент, а затем помещены на свет на 1 час, чтобы позволить ленточкам сформироваться в присутствии или в отсутствие исрадипина. Как показано на рисунке 6, мы обнаружили, что Ribeye b экспрессируется в OPL контрольных личинок (диметилсульфоксид, ДМСО) (дополнительный материал, рис.S1A и B), но был значительно снижен в OPL личинок, обработанных израдипином (дополнительный материал, рис. S1C и D). Эти данные указывают на то, что приток кальция необходим для правильной экспрессии наиболее заметного белка синаптической ленты в фоторецепторах колбочек.

бездельник кодирует synj1

Мутант slacker s564 ( slak ) был выделен из того же крупномасштабного скрининга визуального поведения, который идентифицировал wud , и был генетически сопоставлен с LG10 (22).Помимо отсутствия OKR, slak также имеет фенотип потери равновесия, указывающий на вестибулярный дефект (35). Чтобы дополнительно охарактеризовать этот мутант, мы выполнили ТЭМ и обнаружили, что slak имели плавающие синаптические ленты на 7 dpf (рис. 8A и B). Из-за положения на карте и фенотипа мы предсказали, что slak может быть новым аллелем synj1 . Чтобы проверить эту идею, мы провели тест на комплементацию с nrc , мутантом с преждевременным стоп-кодоном в synj1 (11).Мы обнаружили, что slak не дополняет nrc , что указывает на то, что slak является новым аллелем synj1 . Секвенирование кДНК synj1 из мутантов slak выявило делецию 14 нуклеотидов между экзоном 20 и экзоном 21. Последующее секвенирование геномной ДНК из slak подтвердило изменение одного нуклеотида в донорном сайте сплайсинга интрона 20 (G на A). , рис. 8C), что вызвало сдвиг рамки считывания из-за скрытого донорного сайта сплайсинга и привело к преждевременному стоп-кодону в экзоне 21, который усекает белок по аминокислоте 926 (фиг.8Д).

Рисунок 8.

slak s564 кодирует синаптоянин 1 (Synj1). ( A и B ) Трансмиссионная электронная микроскопия, показывающая нормальные ленты у личинок дикого типа (стрелки на A) и плавающие ленты у мутантов slak на 7 dpf (стрелки на B). ( C ) Схематическое изображение мутации донорного сайта сплайсинга в slak , которая вызывает сдвиг рамки считывания в кодирующей последовательности. Мутация G в A в slak приводит к появлению скрытого сайта сплайсинга на 14 п.н. выше исходного сайта и дает преждевременный стоп-кодон.ИГХ Synj1 и Cacna1f у мутантов slak на 4 дпф. Synj1 экспрессируется в OPL и IPL ( E и G ), тогда как Cacna1fa экспрессируется только в OPL ( F и G ) у дикого типа (WT). У мутантов synj1 Synj1 отсутствует как в OPL, так и в IPL ( H и J ), тогда как Cacna1fa экспрессируется в OPL ( I и J ). Масштабная линейка: (А) и (В), 500 нм; (G) и (J), 20 мкм.

Рис 8.

slak s564 кодирует Synaptojanin 1 (Synj1). ( A и B ) Трансмиссионная электронная микроскопия, показывающая нормальные ленты у личинок дикого типа (стрелки на A) и плавающие ленты у мутантов slak на 7 dpf (стрелки на B). ( C ) Схематическое изображение мутации донорного сайта сплайсинга в slak , которая вызывает сдвиг рамки считывания в кодирующей последовательности. Мутация G в A в slak приводит к появлению скрытого сайта сплайсинга на 14 п.н. выше исходного сайта и дает преждевременный стоп-кодон.ИГХ Synj1 и Cacna1f у мутантов slak на 4 дпф. Synj1 экспрессируется в OPL и IPL ( E и G ), тогда как Cacna1fa экспрессируется только в OPL ( F и G ) у дикого типа (WT). У мутантов synj1 Synj1 отсутствует как в OPL, так и в IPL ( H и J ), тогда как Cacna1fa экспрессируется в OPL ( I и J ). Масштабная линейка: (А) и (В), 500 нм; (G) и (J), 20 мкм.

Чтобы изучить экспрессию белка Synj1, мы провели IHC на личинках slak , используя как Synj1-специфическое антитело рыбок данио (13), так и наше Cacna1fa-специфичное антитело.Как было показано ранее для аллеля nrc (13), мы обнаружили сильную экспрессию Synj1 как в OPL, так и в IPL личинок дикого типа (рис. 8E и G). Мы не обнаружили обнаруживаемого Synj1 в OPL или IPL мутантов slak (рис. 8H и J), что указывает на то, что slak , вероятно, является нулевым аллелем synj1 . Поскольку синаптические ленты образуются у synj1 мутантов, мы предсказали, что экспрессия и локализация Cacna1fa будут нормальными у synj1 мутантов.Действительно, мы обнаружили, что Cacna1fa обнаруживается на аналогичных уровнях в OPL как личинок дикого типа (рис. 8F и G), так и мутантов slak (рис. 8I и J), что указывает на то, что Synj1 не требуется для экспрессии или локализация Cacna1fa. Присутствие Cacan1fa в OPL мутантов slak , которые имеют ленты в синапсах (хотя и неприкрепленные), подтверждает существенную роль Cacna1fa в формировании синаптических лент фоторецепторов.

Synj1 играет важную роль в функции синаптической ленты, особенно в закреплении синаптической ленты фоторецепторов (11–13).Мы предсказали, что экспрессия Synj1 у мутантов wud может быть нарушена из-за отсутствия синаптических лент фоторецепторов. Как и ожидалось, Synj1 совместно локализовался с Cacna1fa в OPL личинок дикого типа через 3 и 5 дней в день (дополнительный материал, рис. S2A-C и G-I). Synj1 первоначально экспрессировался как в OPL, так и в IPL мутантов wud на 3 днях в день (дополнительный материал, рис. S2D-F), когда начинают формироваться фоторецепторы и синаптические ленты. Однако экспрессия Synj1 не обнаруживалась в OPL мутантов wud через 5 дпф и на более поздних стадиях (дополнительный материал, рис.S2J–L). Кроме того, мы исследовали экспрессию личинок Synj1 дикого типа, обработанных исрадипином, чтобы определить, регулируется ли экспрессия Synj1 притоком кальция. Мы обнаружили, что экспрессия Synj1 значительно снижается у личинок, получавших исрадипин (дополнительный материал, рис. S2O и P). Эти данные предполагают, что приток кальция через Cacna1fa не является существенным для начальной экспрессии Synj1, но что приток кальция, вероятно, необходим для устойчивой экспрессии Synj1.

ОБСУЖДЕНИЕ

В этом исследовании мы демонстрируем, что молекулярные дефекты, связанные со слепотой у мутанта wud , обусловлены мутациями в гене L-VDCC, cacna1fa .Учитывая, что: (i) мы обнаружили преждевременные стоп-кодоны в cacna1fa из двух независимых аллелей мутанта wud ; (ii) мутации в гене CACNA1F человека вызывают заболевание сетчатки; (iii) паттерн экспрессии дикого типа cacna1fa локализован на фоторецепторах рыбок данио и отсутствует у мутантов wud ; (iv) мутанты wud демонстрируют аномальные ERG и (v) формирование синаптической ленты колбочек дефектно у мутантов wud , мы убедительно продемонстрировали, что мутантный фенотип wud обусловлен мутациями в cacna1fa .

Мы идентифицировали два паралога рыбок данио человека CACNA1F , cacna1fa и cacna1fb . Из-за дупликации всего генома у рыбок данио многие гены рыбок данио имеют один или несколько паралогов, которые либо имеют перекрывающиеся функции и экспрессию, либо имеют разные паттерны экспрессии. Интересно, что оба гена cacna1f рыбок данио, по-видимому, экспрессируются в сетчатке по взаимоисключающим паттернам и расположены в двух отдельных синаптических слоях сетчатки.У мышей Cacna1f экспрессируется во многих слоях сетчатки, включая OPL и IPL (27). Этот паттерн экспрессии согласуется с распределением синаптических лент как в фоторецепторах, так и в биполярных клетках (2). Однако у рыбок данио оказалось, что ген cacna1f был дуплицирован в два независимых гена с различными паттернами экспрессии. Это открытие может быть большим преимуществом для изучения функции Cacna1fa специфически в фоторецепторах колбочек без осложнений, связанных с вовлечением биполярных клеток.

Известно, что CACNA1F (Ca v 1.4) играет важную роль в синаптической передаче фоторецепторов. Как упоминалось ранее, мутации в гене CACNA1F человека вызывают CSNB2 и дистрофию колбочек (16–18,36). CSNB2 представляет собой клинически вариабельную группу нарушений зрения, характеризующихся аномальными ЭРГ, нарушением ночного зрения, снижением остроты зрения, близорукостью, нистагмом и косоглазием (37–39). Исследования на мышах показали, что Cacna1f жизненно важен для функциональной сборки и/или поддержания ленточных синапсов палочек фоторецепторов (27).Это исследование также показало глубокую потерю функции фоторецепторов колбочек, что продемонстрировано ЭРГ, хотя неясно, как и почему колбочки затронуты в этой модели. В отличие от сетчатки с преобладанием палочек у мышей, у рыбок данио сетчатка с преобладанием колбочек, сравнимая с центральной ямкой сетчатки человека, что делает рыбок данио дополнительной моделью заболеваний сетчатки. Синаптическая передача в палочках и колбочках несколько отличается, что отражается в изменении количества и размера синаптических лент. Т.о., сетчатка с преобладанием колбочек наряду с дивергентным паттерном экспрессии cacna1f делает мутант wud уникальным инструментом для изучения роли кальциевых каналов в синапсах фоторецепторов колбочек.

Почему ЭРГ ненормальна у wud мутантов? Предыдущие исследования на мышах показали, что мутации в кальциевых каналах фоторецепторов приводят к аномальной синаптической передаче в фоторецепторах палочек (20, 27, 40). Хотя можно было предсказать, что мутации у рыбок данио cacna1fa приведут к нарушению синаптической передачи, мы также обнаружили медленный положительный компонент ЭРГ, который напоминал с-волну. Хорошо известно, что с-волна возникает в пигментном эпителии сетчатки (ПЭС) (41).Таким образом, возможно, что пигмент сетчатки сенсибилизирован у мутантов wud . Интересно, что у мышей с мутацией потери функции в Cacna1f не индуцируются ERG колбочек (27). Скорее всего, это связано с дегенерацией колбочковых фоторецепторов у мутантов мышей с полной потерей Cacna1f (42). Напротив, у пациентов с CSNB2 обнаруживаются вариабельные ERG колбочек (19), и у этих пациентов не было сообщений о дегенерации колбочек. Фактически, ЭРГ колбочек у некоторых из этих людей показывает медленный положительный компонент, который чем-то напоминает мутант wud (19).

Альтернативно, аномальный фенотип ERG у wud можно объяснить дупликацией генома у рыбок данио. Человек и мышь содержат один ген CACNA1F , который экспрессируется во многих слоях сетчатки. Напротив, у рыбок данио есть два гена cacna1f , из которых cacna1fa (ген wud ) экспрессируются в слое фоторецепторов, а cacna1fb экспрессируются во внутренней части сетчатки. Возможно, присутствие cacna1fb во внутренней части сетчатки вызывает медленный положительный компонент wud ЭРГ.Хотя это остается возможным, мы не увидели каких-либо изменений в фенотипе ERG при применении APB (данные не показаны). Это указывало бы на то, что аномальная ЭРГ возникает выше внутренней сетчатки, и поддерживает представление о том, что этот компонент происходит от фоторецепторов колбочек или RPE.

Здесь мы сообщили о позиционном клонировании двух слепых мутантных линий рыбок данио с дефектными синапическими лентами фоторецепторов колбочек. Мутанты wud полностью лишены синаптических лент, а мутанты slak имеют плавающие синаптические ленты.Оба мутанта предоставляют уникальную возможность препарировать образование синаптических лент. В ленточных синапсах синаптические ленты прикрепляются к дугообразной плотности посредством взаимодействия с фаготом (9). Synj1 также играет важную роль в прикреплении ленты к плазматической мембране, хотя точный молекулярный механизм остается неизвестным, так как компоненты дугообразной плотности не идентифицированы. Возможно, Synj1 является компонентом дугообразной плотности, облегчающим взаимодействие с белками синаптических лент, такими как Bassoon.Эта возможность может быть интересной, учитывая, что мышиные мутанты Bassoon также имеют плавающие ленты (9).

В отличие от мутантов slak , синаптические ленты полностью отсутствуют у мутантов wud (рис. 5C и D). Однако мы обнаружили низкие уровни белка Ribeye b на синаптических окончаниях и неправильно локализовали Ribeye b во внутренних сегментах (рис. 6). Интересно, что мы не обнаружили значительных изменений в уровне мРНК ribeye b , что указывает на то, что сниженная экспрессия не регулируется транскрипцией.Хотя синаптические ленты отсутствовали у мутантов wud , мы отметили присутствие предполагаемого srPB (рис. 5C и D). Это может свидетельствовать о том, что некоторые компоненты, необходимые для образования синаптических лент, присутствуют, но сборка лент дефектна. Неожиданно мы обнаружили, что Synj1 отсутствовал у мутантов wud , что указывает на то, что Cacna1fa и приток кальция могут играть роль в регуляции Synj1. Возможно, эта форма регуляции важна для других ленточных белков, что в конечном итоге приводит к потере синаптических лент.

Какую роль играют L-VDCC в формировании синаптической ленты? Одна из возможностей заключается в том, что L-VDCC обеспечивают структурный каркас для взаимодействий ленточных белков. Например, структурные дефекты в синапсе фоторецептора ранее наблюдались у мышей с целенаправленным нарушением генов, связанных с синаптической лентой, таких как Bassoon (9) и Pikachurin (7). Недавние исследования также показали, что потеря либо фагота, либо рибай влияет на обилие или локализацию кальциевых каналов L-типа (Ca v 1.3) в ленточном синапсе волосковых клеток (31, 43), что указывает на тесную связь между L-VDCCs и белками синаптической ленты. Это было дополнительно продемонстрировано у мышей с двойным нокаутом P/Q- и N-типа VDCC, где экспрессия Bassoon и Piccolo была снижена в пресинаптической активной зоне нервно-мышечного соединения (44). Также предполагается, что Ca v 1.4 может косвенно взаимодействовать с белками синаптической ленты (45). Например, отдельные взаимодействия между Ca и 1.4 и CaBP4 (46), CaBP4 и Munc119 (47) и Munc119 и Ribeye (48) могут обеспечить механизм для закрепления синаптической ленты на кальциевых каналах. Однако, если бы единственная роль Ca v 1.4 заключалась в обеспечении каркаса для закрепления синаптической ленты, то можно было бы ожидать увидеть плавающие ленты у мутанта wud , подобные тем, что ранее были показаны у рыбок данио nrc. мутант (11) и наш slak мутант .

Образование синаптической ленты также может регулироваться L-VDCCs посредством притока кальция.Синаптические ленты фоторецепторов претерпевают зависящие от активности изменения из-за уровня освещения (49), который, как было показано, зависит от концентрации кальция и цГМФ (50). Например, хелатирование внутриклеточного кальция приводит к разборке синаптических лент в фоторецепторных клетках (51). Недавнее исследование также предположило, что кальциевый сенсорный белок, активирующий guanylyl cyclase, белок 2, GCAP2, является главным кандидатом на опосредование динамических кальций-зависимых изменений в синаптических лентах (52).Хотя прямая связь между кальцием и синаптическими лентами остается неизвестной, хорошо задокументировано, что кальций играет жизненно важную роль в высвобождении нейромедиаторов, регуляции активности кальциевых каналов с помощью кальмодулина и CaBP4 (46,53) и кальций-зависимой транскрипции генов (54). . Кроме того, недавнее исследование Sheets et al . показали, что приток кальция через каналы Ca v 1.3 регулирует сборку или накопление белка Ribeye в сенсорных волосковых клетках рыбок данио и пинеалоцитах (33).В этом исследовании мы продемонстрировали, что Ribeye b значительно подавлен и неправильно локализован у мутантов wud и что блокатор кальциевых каналов L-типа исрадипин нарушил экспрессию белков синаптической ленты Synj1 и Ribeye b. В совокупности представляется вероятным, что приток кальция влияет на структуру и формирование синаптических лент и способствует потере синаптических лент у мутанта wud .

Наше клонирование и характеристика мутанта wud рыбок данио дает ценную модель, не относящуюся к млекопитающим, для анализа функции кальциевых каналов в фоторецепторах колбочек.Результаты нашего фенотипического анализа в свете недавних исследований на мышах позволяют предположить, что отсутствие Ca v 1.4 в колбочках приводит к полной потере синаптических лент и указывает на существенную роль кальциевых каналов на начальных этапах синаптических лент. разработка. Кроме того, наш электрофизиологический анализ продемонстрировал потенциально дополнительные функции кальциевых каналов в фоторецепторах колбочек. Будущие исследования с мутантом wud могут дополнительно помочь раскрыть роль, которую кальциевые каналы играют в регуляции образования синаптических лент на молекулярном уровне, и в конечном итоге могут привести к пониманию родственных заболеваний сетчатки человека.

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы рыбок данио и идентификация мутантов

рыбки данио были выращены и содержались в стандартных условиях. Личинки содержались в яичной воде (0,03% Instant Ocean, восстановленной водой обратного осмоса), если не указано иное. Множественные аллели мутанта wud и один аллель slacker s564 ( slak ) были выделены в результате широкомасштабного скрининга мутагенеза дефектов зрительного поведения (22).Для этого исследования мы проанализировали аллели wud s129 , wud s315 и slak . Для всех экспериментальных процедур рыбок данио поддерживали в штамме TL. Для экспериментов по генетическому картированию гетерозиготные носители аллеля wud s129 скрещивали со штаммом WIK. Для комплементарного анализа гетерозигот slak были скрещены с гетерозиготами без оптокинетического ответа c ( nrc )Сьюзен Брокерхофф, Вашингтонский университет) (11). Чтобы идентифицировать личинок дикого типа и мутантных личинок от взрослого гетерозиготного скрещивания, мы измерили OKR, как описано ранее (22,55). Личинки на 5–7 dpf были оценены как дикие (OKR+) или мутантные (OKR-) на основании их визуальных ответов. Для некоторых экспериментов IHC wud s129 личинок были получены путем оплодотворения in vitro с использованием спермы и яйцеклеток, собранных от wud гомозиготных взрослых особей. Эксперименты на живых животных проводились в соответствии с рекомендациями Ст.Комитет по институциональному уходу и использованию животных Детской исследовательской больницы Джуда.

Гистологический анализ

Личинок анестезировали 0,02% трикаином, фиксировали 4% параформальдегидом в PBS при 4°C в течение ночи или 30 минут при комнатной температуре, уравновешивали 30% сахарозой в PBS, помещали в O.C.T. соединения (Tissue-Tek) и делали срезы размером 15 мкм на криостате (Leica). Срезы блокировали в 5% нормальной козьей сыворотке, 0,3% Trixon X-100 в PBS и инкубировали со следующими первичными антителами, разведенными в блокирующем буфере: анти-PKCβ1 (разведение 1:800; Santa Cruz Biotechnology), zpr-1 (1: 200 в разведении; Международный ресурсный центр рыб данио), анти-SV2 (разведение 1:250, DSHB, Университет Айовы) и анти-рибай b (разведение 1:250; любезно предоставлено докторомTeresa Nicolson, Oregon Health & Science University), анти-Synj1 (неразбавленный; любезно предоставлен доктором Сьюзан Брокерхофф, Вашингтонский университет) и анти-Cacna1fa (разведение 1:6000). Чтобы получить поликлональное антитело Cacna1fa рыбки данио, мы создали GST-меченый С-концевой фрагмент Cacna1fa (аминокислота 1581–1811) в качестве антигена, а Proteintech изготовила антитело кролика. Предметные стекла промывали в PBS три раза по 10 минут на промывку, а затем инкубировали с конъюгированными с Alexa488, Alexa568 или Alexa 647 козьими антимышиными или антикроличьими IgG (разведение 1:1000, Invitrogen) и контрастно окрашивали 4′,6 -диамидино-2-фенилиндол (DAPI; 1 мкг/мл) для окрашивания ядер.

Полутонкие пластиковые профили

пластиковых среза JB4 были получены, как описано ранее (56). Личинки дикого типа и мутантные личинки через 7 дпф фиксировали в 4% параформальдегиде при 4°С в течение ночи. После многократной промывки в PBS личинок последовательно дегидратировали в этаноле в PBS (5, 25, 50, 75% этанола в PBS) с последующей окончательной дегидратацией в 100% этаноле. Этанол заменили раствором для инфильтрации (мини-набор для заливки JB-4, Polysciences Inc.) и заменяли свежим раствором для инфильтрации, когда личинки оседали на дно пробирки. После инкубации в течение ночи образцы заливали в смолу JB-4 (мини-набор для заливки JB-4, Polysciences Inc.). Делали срезы (1 мкм) и окрашивали гематоксилином и эозином. Изображения были получены на микроскопе Nikon E800 с камерой Nikon DXM1200 и проанализированы с помощью программного обеспечения NIS Elements AR3.0. Данные были получены от четырех диких типов и четырех мутантов. Были измерены два среза от каждой рыбы в трех областях, близких к зрительному нерву, всего 24 точки данных для каждой группы.GraphPad Prism 5.0 (программное обеспечение GraphPad) использовали для выполнения непарного t -теста для статистического анализа.

Электроретинограммы

Личинки рыбок данио

на 5–6 dpf были анестезированы путем погружения в 0,02% трикаин в 0,09% Instant Ocean на 1 мин, а затем осторожно помещены на влажную губку в записывающую камеру RC-10 (Warner Instruments). Личинки располагали так, чтобы один глаз был направлен на световой раздражитель. Стеклянные регистрирующие электроды натягивали на съемник микропипеток P-97 (Sutter Instrument) и полировали огнем до диаметра кончика ~20 мкм с использованием Micro-Forge MF-200 (World Precision Instruments).Регистрационная камера и электрод были заполнены 0,02% трикаином в 0,09% растворе Instant Ocean. Перед записью образец адаптировали к темноте в течение 10 мин. Регистрирующий электрод устанавливали непосредственно на роговицу с помощью микроманипулятора при инфракрасном освещении. Электрод сравнения помещали в соседний наземный резервуар. Свет генерировался корпусом лампы QTH (кварц-вольфрам-галоген) Oriel мощностью 100 Вт и располагался на расстоянии 5 см от образца с использованием жидких световодов (Newport). Неослабленный световой стимул был установлен на 2 мВт/см 2 .Продолжительность стимула 20 мс контролировалась драйвером затвора VCM-D1 и затвором VS25 (Uniblitz) с использованием программного обеспечения pCLAMP 10 (Molecular Devices) и ослаблялась с помощью фильтров нейтральной плотности, охватывающих диапазон 3 логарифмических единиц. Сигнал напряжения фильтровался шумоподавителем Hum Bug 50/60 Гц (Quest Scientific), усиливался дифференциальным усилителем DP-311 (настройки: фильтр высоких частот 0,1 Гц, фильтр нижних частот 100 Гц и усиление 10 3 ; Warner Instruments), оцифровано с помощью Digidata 1440A (Molecular Devices), получено и проанализировано с помощью программного обеспечения pCLAMP 10 (Molecular Devices).Каждая трасса представляет собой среднее значение шести испытаний, снятых с интервалом в 20 с. Все ЭРГ проводились при комнатной температуре (22–24°C).

Генетическое картирование и позиционное клонирование

Генетическое картирование было выполнено с использованием методов картирования сцепления на основе микросателлитов с помощью группового сегрегантного анализа с использованием 192 пар полиморфных праймеров, равномерно распределенных по геному рыбок данио. Как описано ранее (22), wud был сопоставлен с LG 8, а slak был сопоставлен с LG 10.Точное картирование wud определило критический интервал в 4,7 Мб между маркерами z789 и z15786. Точное картирование slak определило критический интервал в 1,2 Мб между маркерами z7504 и z9574. Чтобы оценить выбранные гены-кандидаты, мы секвенировали кДНК как мутантов, так и их братьев и сестер дикого типа. Тотальную РНК экстрагировали из 20 личинок дикого типа (OKR+) и 20 мутантных (OKR-) личинок с использованием TRIzol (Invitrogen), кДНК синтезировали с использованием набора SuperScript III First Strand Synthesis Kit (Invitrogen) и проводили ПЦР в двух повторах с перекрывающейся ДНК. пары праймеров, специфичные для открытой рамки считывания оцениваемого гена рыбок данио (последовательности праймеров доступны по запросу).Продукты ПЦР обрабатывали на 1% агарозном геле, экстрагировали с использованием набора QIAquick Gel Extraction Kit (Qiagen) и секвенировали.

Цельное

in situ гибридизация

WISH выполняли, как описано ранее (57). Вкратце, личинок фиксировали в 4% параформальдегиде при 4°C в течение ночи, обезвоживали в 100% метаноле и хранили при -20°C. Личинок регидратировали в PBS, пермеабилизировали протеиназой К, предварительно гибридизовали при 70°C в течение 2 ч и гибридизовали с дигоксигнеин-мечеными РНК-зондами при 70°C в течение ночи.Для синтеза зонда cacna1fa (нуклеотиды 4642–6273) и cacna1fb (нуклеотиды 5132–6622) были амплифицированы методом ПЦР из кДНК рыбок данио дикого типа и клонированы в двойной промоторный вектор pCRII-TOPO (Invitrogen). Смысловые и антисмысловые РНК-зонды, меченные DIG, синтезировали с помощью РНК-полимеразы Sp6 и T7 с использованием набора для мечения РНК DIG (Roche). После промывки и блокировки личинок инкубировали с Fab-фрагментом анти-DIG-AP в течение 2 ч и окрашивали субстратом BCIP/NBT до появления желаемой интенсивности сигнала.Окрашенные личинки были помещены в глицерин для визуализации или встроены в ОКТ. соединение, замороженное на сухом льду и срезы размером 10 мкм с использованием криостата Leica CM1950.

Иммуноблоттинг

Целые глаза взрослых рыбок данио гомогенизировали в 100 мкл буфера для гомогенизации [таблетки полного коктейля ингибиторов протеиназ (Roche) в 25 мл воды] с помощью пестика-пеллета (Kontes). Добавляли буфер для образцов Лэммли и образцы кипятили в течение 10 мин. Белки разделяли на 4–12% сборных TGX-гелях Bio-Rad и переносили на нитроцеллюлозную мембрану (Millipore).Мембраны блокировали в течение 10 мин в 10% обезжиренном сухом молоке (Sysco) в TBST, инкубировали с первичными антителами в течение ночи при 4°C, а затем с вторичными антителами IRDye, разведенными в блокирующем буфере Odyssey (LI-COR). Сигналы регистрировали с помощью системы инфракрасной визуализации Odyssey (LI-COR) при 680 и 800 нм. Используемые первичные антитела представляли собой мышиные моноклональные антитела против актина (1:6000, Proteintech) и кроличьи поликлональные антитела против Cacna1fa (1:500, Proteintech). Используемые вторичные антитела представляли собой антимышиные IgG (IRDye 800) и антикроличьи IgG (IRDye 680).

Просвечивающая электронная микроскопия

Взрослые глаза или целые личинки (3–7 dpf) фиксировали в 4% глутаральдегиде в 0,1 М буфере какодилата натрия (рН 7,4) и постфиксировали в 2% четырехокиси осмия в 0,1 М буфере какодилата натрия с 0,3% ферроцианида калия в течение 2 часов. . Образцы ( n = 4 для взрослых глаз, n = 3 или 5 для целых личинок) серийно обезвоживали в этаноле, а затем серийно переносили в пропиленоксид. Образцы пропитывали и заливали эпоксидной смолой и полимеризовали при 70°C в течение ночи.Полутонкие срезы (0,5 мкм) окрашивали толуидиновым синим для исследования под световым микроскопом. Ультратонкие срезы (80 нм) делали на ультрамикротоме Leica EM UC6 и визуализировали с помощью электронного микроскопа JEOL 1200, оснащенного камерой AMT XR 111.

Количественная ОТ-ПЦР

сетчатки вырезали у четырех особей взрослых рыбок данио (возраст 4 месяца). Обе сетчатки отдельных рыб объединяли. Тотальную РНК получали с помощью TRIzol (Invitrogen) и дополнительно очищали с помощью колонок RNeasy (Qiagen), как описано (58).кДНК синтезировали с использованием набора для обратной транскрипции QuantiTect (Qiagen). Количественную ОТ-ПЦР проводили с использованием мастер-микса SYBR Green PCR (Applied Biosystems) в системе быстрой ПЦР в реальном времени Applied Biosystems 7900HT, как описано (59). Образцы анализировали в трех повторностях и нормализовали по β-актину. Были использованы следующие праймеры:

Рибай б вперед: GCTTCAGCCACCGTAATGAT

Рибай б резерв: TTCCAGTAGATGCTGCGATG

β- актина вперед: TGAATCCCAAAGCCAACAGAG

β- актина обратном: TCACACCATCACCAGAGTCC

Фармакологическая блокада кальция приток

Адаптированные к темноте личинки дикого типа при 7 dpf подвергались воздействию света в течение 1 часа (~200 мкВт) в присутствии 0.1% DMSO/Embryo Medium (E3) (контроль) или 10 мкМ исрадипина (Sigma I6658-5MG) в 0,1% DMSO/E3. Эмбрионы выращивали в темноте от 1 dpf до обработки лекарством. После обработки личинок фиксировали в 4% параформальдегиде, делали срезы и исследовали с помощью ИГХ.

ДОПОЛНИТЕЛЬНЫЙ МАТЕРИАЛ

Дополнительный материал

доступен на веб-сайте HMG в Интернете.

ФИНАНСИРОВАНИЕ

Эта работа была поддержана глазным фондом рыцарей-тамплиеров (SJ), грантами EY12406 и EY13855 Национального института здравоохранения (NIH) (H.B.) и Фонд Э. Матильды Циглер для слепых, Детская исследовательская больница Св. Иуды и ALSAC (MRT). Конфокальная микроскопия и просвечивающая электронная микроскопия были выполнены в Центре визуализации клеток и тканей Детской исследовательской больницы Св. Иуды, который поддерживается грантом Национального института здравоохранения NCI P30 CA021765-34.

БЛАГОДАРНОСТЬ

Мы благодарим доктора Хуана Коренброта (UCSF) за помощь с электроретинограммами, Шэрон Фрейз и Яннана Оуяна из Центра визуализации клеток и тканей в Сент-Луисе.Jude Children’s Research Hospital за их помощь с электронным и конфокальным микроскопом, а также членов групп Тейлора и Байера за помощь в скрининге мутагенеза и обслуживании рыбных объектов.

Заявление о конфликте интересов . Ни один не заявил.

ССЫЛКИ

1,  ,  ,  ,  ,  .

Кодирование интенсивности света синапсом фоторецептора колбочек

,

Нейрон

,

2005

, vol.

48

 (стр. 

555

562

)2,  .

Структура и функция ленточных синапсов

Trends Neurosci.

,

2005

, том.

28

 (стр. 

20

29

)3.

Создание синаптических лент: как они устроены и что они делают

15

 (стр. 

611

624

)4,  .

Ленточные синапсы сетчатки

,

Cell Tissue Res.

,

2006

, том.

326

 (стр. 

339

346

)5,  .

Молекулярная архитектура ленточных пресинаптических окончаний

Mol. Нейробиол.

,

2009

, том.

39

 (стр. 

130

148

)6,  ,  ,  ,  ,  .

Роль синаптической ленты в передаче светового ответа колбочек

Nat. Неврологи.

,

2009

, том.

12

 (стр. 

303

310

)7,  ,  ,  ,  ,  ,  ,  ,  ,  , и др.

Пикачурин, лиганд дистрогликана, необходим для образования синапсов фоторецепторной ленты

,

Nat.Неврологи.

,

2008

, том.

11

 (стр. 

923

931

)8,  ,  ,  ,  ,  ,  ,  ,  ,  .

TMEM16B, новый белок с активностью кальций-зависимого хлоридного канала, связывается с пресинаптическим белковым комплексом в окончаниях фоторецепторов

,

J. Neurosci.

,

2009

, том.

29

 (стр. 

6809

6818

)9,  ,  ,  ,  ,  ,  ,  .

Белок пресинаптической активной зоны фагот необходим для формирования синапсов фоторецепторной ленты в сетчатке

37

 (стр. 

775

786

)10,  ,  ,  .

Образование синапсов задержано в фоторецепторах сетчатки рыбок данио nrc мутантных

,

J. Neurosci.

,

2001

, том.

21

 (стр. 

2330

2342

)11,  ,  ,  ,  ,  ,  .

Мутант nrc рыбок данио раскрывает роль полифосфоинозитидфосфатазы synaptojanin 1 в закреплении ленты фоторецептора колбочек

,

J. Neurosci.

,

2004

, том.

24

 (стр. 

8641

8650

)12,  ,  ,  ,  .

Synaptojanin1 необходим для временной точности синаптической передачи в волосковых клетках

,

PLoS Genet.

,

2009

, том.

5

стр.

e1000480

 13,  ,  ,  .

Дифференциальная роль синаптоянина 1 в фоторецепторах палочек и колбочек

,

J. Comp. Нейрол.

,

2009

, том.

517

 (стр. 

633

644

)14,  ,  .

Два гена рибай у костистых рыб: роль рибайя в формировании лент и развитии биполярных клеток

J.Неврологи.

,

2005

, том.

25

 (стр. 

941

949

)15,  .

Различные роли ленточных синапсов в сенсорной нейротрансмиссии

Nat. Rev. Neurosci

,

2010

, том.

11

 (стр. 

812

822

)16,  ,  ,  ,  ,  ,  ,  ,  .

Мутации потери функции в гене альфа1-субъединицы кальциевого канала в Xp11.23 вызывают неполную сцепленную с Х-хромосомой врожденную стационарную куриную слепоту

Nat.Жене.

,

1998

, том.

19

 (стр. 

264

267

)17,  ,  ,  ,  ,  ,  .

Колбочково-стержневая дистрофия, сцепленная с Х-хромосомой, CORDX3, вызывается мутацией в гене CACNA1F

,

J. Med. Жене.

,

2006

, том.

43

 (стр. 

699

704

)18,  ,  ,  ,  ,  ,  ,  ,  ,  , и др.

Ген кальциевых каналов L-типа мутировал при неполной Х-сцепленной врожденной стационарной куриной слепоте

,

Nat. Жене.

,

1998

, том.

19

 (стр. 

260

263

)19,  ,  ,  ,  .

Врожденная стационарная куриная слепота с отрицательной электроретинограммой. Новая классификация

,

. Арх. Офтальмол .

,

1986

, том.

104

 (стр. 

1013

1020

)20,  ,  ,  ,  ,  ,  ,  ,  ,  , и др.

Мышь nob2, нулевая мутация в Cacna1f: анатомические и функциональные аномалии внешней части сетчатки и их влияние на зрительные реакции ганглиозных клеток

Vis.Неврологи.

,

2006

, том.

23

 (стр. 

11

24

)21,  ,  ,  ,  ,  ,  ,  .

Модифицированная экспрессия Ca(v)1.4 у мыши Cacna1f(nob2) из-за альтернативного сплайсинга ETn, вставленного в экзон 2

3

стр.

e2538

 22,  ,  ,  ,  ,  ,  ,  ,  ,  , и др.

Прямой генетический анализ зрительного поведения рыбок данио

,

PLoS Genet.

,

2005

, том.

1

стр.

e66

 23,  ,  .

Вклад палочек в электроретинограмму адаптированных к темноте развивающихся рыбок данио

Dev. Дин.

,

2001

, том.

222

 (стр. 

564

570

)24,  ,  ,  .

Исследования синаптической передачи фоторецепторов и адаптации к свету у зрительных мутантов рыбок данио nrc

,

Invest. Офтальмол. Вис. науч.

,

2001

, том.

42

 (стр. 

868

874

)25,  ,  ,  .

Мутация в специфичном для колбочек гене pde6 вызывает быструю дегенерацию фоторецепторов колбочек у рыбок данио

,

J. Neurosci.

,

2007

, том.

27

 (стр. 

13866

13874

)26,  .

Палочковидные биполярные клетки и горизонтальные клетки образуют смещенные синаптические контакты с палочками во внешнем ядерном слое сетчатки nob2

,

J. Comp. Нейрол.

,

2007

, том.

500

 (стр. 

286

298

)27,  ,  ,  ,  ,  ,  ,  ,  .

Мутация гена кальциевого канала Cacna1f нарушает передачу сигналов кальция, синаптическую передачу и клеточную организацию в сетчатке мыши

Hum. Мол. Жене.

,

2005

, том.

14

 (стр. 

3035

3046

)28,  ,  .

RIBEYE, компонент синаптических лент: эволюция белка дает представление о функционировании синаптических лент

28

 (стр. 

857

872

)29,  ,  ,  ,  .

Ранние этапы сборки ленточных синапсов фоторецепторов в сетчатке мыши: участие сфер-предшественников

,

J. Comp. Нейрол.

,

2009

, том.

512

 (стр. 

814

824

)30,  ,  ,  ,  ,  .

Множественные взаимодействия RIBEYE-RIBEYE создают динамический каркас для формирования синаптических лент

,

J. Neurosci.

,

2008

, том.

28

 (стр. 

7954

7967

)31,  ,  ,  ,  .

Рибай необходим для локализации пресинаптических каналов CaV1.3a и афферентной иннервации сенсорных волосковых клеток.

138

 (стр. 

1309

1319

)32.

Потенциалзависимые кальциевые каналы

,

Колд Спринг Харб. Перспектива. биол.

,

2011

, том.

3

стр.

a003947

 33,  ,  .

Пресинаптические каналы CaV1.3 регулируют размер синаптической ленты и необходимы для поддержания синапсов в сенсорных волосковых клетках

,

J.Неврологи.

,

2012

, том.

32

 (стр.

17273

17286

)34.

Индуцированное темнотой уменьшение количества синаптических лент в сетчатке рыб

,

Природа ,

,

1973

, том.

246

 (стр. 

53

55

)35,  ,  ,  ,  ,  .

Генетический анализ механоощущения сенсорных волосковых клеток позвоночных: мутанты круга рыбок данио

,

Neuron

,

1998

, vol.

20

 (стр.

271

283

)36,  ,  ,  ,  ,  ,  ,  ,  ,  .

Обзор 20 мутаций CACNA1F, выявленных в 36 семьях с неполной Х-сцепленной врожденной стационарной куриной слепотой, и характеристика сплайс-вариантов

,

Hum. Жене.

,

2001

, том.

108

 (стр. 

91

97

)37,  ,  .

Клиническая изменчивость среди пациентов с неполной сцепленной с Х-хромосомой врожденной стационарной куриной слепотой и мутацией-основателем CACNA1F

,

Can.Дж. Офтальмол.

,

2000

, том.

35

 (стр. 

204

213

)38,  ,  ,  ,  ,  ,  .

Фенотипическое проявление полного типа Х-сцепленной врожденной стационарной куриной слепоты у пациентов с различными мутациями в гене NYX

,

Graefes Arch. клин. Эксп. Офтальмол.

,

2002

, том.

240

 (стр. 

822

828

)39,  ,  ,  ,  ,  ,  ,  ,  ,  , и др.

Врожденная стационарная куриная слепота у мышей – рассказ о двух мутантах Cacna1f

Adv.Эксп. Мед. биол.

,

2010

, том.

664

 (стр. 

549

558

)40,  ,  ,  ,  ,  .

Роль бета(2) субъединицы потенциал-зависимых кальциевых каналов в наружном плексиформном слое сетчатки

,

Invest. Офтальмол. Вис. науч.

,

2002

, том.

43

 (стр. 

1595

1603

)41. ,  ,  .

Электроретинограмма: ERG

,

Webvision: Организация сетчатки и зрительной системы

Мозаичная синаптопатия и функциональные дефекты у гетерозиготных мышей Cav1.4 и людей-носителей CSNB2

,

Hum. Мол. Жене.

,

2014

, том.

23

 (стр. 

1538

1550

)43,  ,  ,  ,  ,  ,  ,  ,  ,  , и др.

Фагот и синаптическая лента организуют каналы и везикулы Ca(2+), добавляя сайты высвобождения и способствуя восполнению

68

 (стр. 

724

738

)44,  ,  .

Кальциевые каналы связывают мышечный организатор синапсов ламинин бета2 с фаготом и CAST/Erc2 для организации пресинаптических активных зон

,

J. Neurosci.

,

2011

, том.

31

 (стр. 

512

525

)45,  ,  ,  ,  ,  .

EF опосредованная руками передача сигналов Ca- и cGMP в синаптических окончаниях фоторецепторов

,

Front. Мол. Неврологи.

,

2012

, том.

5

стр.

26

 46,  ,  ,  ,  ,  ,  ,  .

Существенная роль Са2+-связывающего белка 4, Cav1.4-канальный регулятор синаптической функции фоторецепторов

,

Nat. Неврологи.

,

2004

, том.

7

 (стр. 

1079

1087

)47.

Взаимодействие и совместная локализация CaBP4 и Unc119 (MRG4) в фоторецепторах

,

Invest. Офтальмол. Вис. науч.

,

2008

, том.

49

 (стр. 

2366

2375

)48,  ,  ,  ,  ,  ,  ,  .

RIBEYE рекрутирует Munc119, ортолог белка unc119 Caenorhabditis elegans млекопитающих, в синаптические ленты синапсов фоторецепторов

,

J.биол. хим.

,

2008

, том.

283

 (стр. 

26461

26467

)49,  ,  ,  .

Синаптические ленты фоторецепторов мыши теряют и восстанавливают материал в ответ на изменение освещения

Eur. Дж. Нейроски.

,

2004

, том.

19

 (стр. 

1559

1571

)50,  .

Пластичность ленточных синапсов сетчатки

,

Microsc. Рез. Тех.

,

1996

, том.

35

 (стр. 

472

487

)51,  ,  ,  .

Стабильность компонентов активной зоны фоторецепторного ленточного комплекса

,

Mol. Вис.

,

2010

, том.

16

 (стр. 

2690

2700

)52,  ,  ,  ,  ,  ,  ,  .

Зависимое от никотинамидадениндинуклеотида связывание нейронального сенсорного белка Ca2+ GCAP2 с синаптическими лентами фоторецепторов

,

J. Neurosci.

,

2010

, том.

30

 (стр. 

6559

6576

)53,  ,  ,  ,  .

Передача сигналов ядру комплексом кальциевый канал-кальмодулин L-типа через MAP-киназный путь

294

 (стр. 

333

339

)54,  ,  ,  ,  ,  ,  .

Каналы Ca(V)1 и Ca(V)2 задействуют разные способы передачи сигналов Ca(2+) для контроля экспрессии CREB-зависимых генов

149

 (стр. 

1112

1124

)55,  ,  ,  ,  ,  .

Поведенческий скрининг для выделения мутантов рыбок данио с дефектами зрительной системы

,

Proc. Натл. акад. науч. США

,

1995

, том.

92

 (стр.

10545

10549

)56,  ,  .

Встраивание, серийные срезы и окрашивание эмбрионов рыбок данио с использованием смолы JB-4

,

Nat. протокол

,

2011

, том.

6

 (стр. 

46

55

)57,  .

Гибридизация in situ с высоким разрешением с цельными эмбрионами рыбок данио

Nat. протокол

,

2008

, том.

3

 (стр. 

59

69

)58,  .

Профилирование экспрессии генов сетчатки эмбрионов рыбок данио

,

Рыбки данио

,

2005

, vol.

2

 (стр. 

269

283

)59,  ,  ,  ,  ,  ,  ,  ,  .

Дублированные гены семейства гельсолинов у рыбок данио: новый сциндериноподобный ген (scinla) кодирует основной кристаллин роговицы

21

 (стр. 

3318

3328

)

Примечания автора

© The Author, 2014. Опубликовано Oxford University Press. Все права защищены. Для разрешений, пожалуйста, по электронной почте: журналы.разрешения@oup.com

Фермерская чашка с цветами из атласных лент. Мастер-класс по изготовлению «парящей чаши»

6 марта 2015 г. Але4ка.

Хотите порадовать близкого человека Оригинальный подарок или внести яркие нотки в интерьер? Тогда вам понравился мастер-класс, который я хочу вам сегодня продемонстрировать. Эта замечательная композиция никого не оставит равнодушным. Если вы хотите сделать приятно любимым и родным, то конечно же знаете, что самый ценный подарок тот, который сделан своими руками.

Есть несколько вариантов летающих кружек, например, в составе используются кофейные зёрна, монетки или даже конфеты, но мы сделаем его с вашими деревцами из цветов. Цветы визуально предают дизайну большую легкость, воздушность и нежность, поэтому этот вариант для меня более привлекателен.

Подготовка к работе

Для изготовления летающей чашечки топиария нам понадобится:

Изготовление каркаса

Самое сложное в изготовлении нашей летающей кружки это конечно каркас, который будет спрятан под цветами.Для изготовления своими руками нам понадобится проволока, которая хорошо держит форму. Отрезаем два одинаковых отрезка проволоки и посередине закрепляем их между собой с помощью скотча. Не оборачивайте проволоку полностью, так как горячий клей лучше взаимодействует с проволокой, и скотч или скотч скоро впьются.

Теперь есть места куда мы будем втыкать проволоку на кружку и блюдце нужно заманить наждачной бумагой.


Согните проволоку и приклейте сначала к чашке, затем к блюдцу. Используем для этого клей — «Момент крайний.»

Обратите внимание на высоту вашей оправы, она не должна быть слишком короткой или длинной, длина должна примерно соответствовать 1,5 длины самой чашки. Также круг не должен выходить за пределы блюдца, иначе ваша композиция будет неустойчивой.

Для того, чтобы рамка хорошо держалась, дайте ему высохнуть, для этого надо подождать, пока кружка с блюдцем высохнет на ночь. Утром можно будет вернуться к работе.

Украшение цветами

Подбираем подходящие листья и цветы.Мой вам совет: Выбирайте самые красивые, качественные цветы, иначе товара будет не так много, как хотелось бы видеть.


Приступаем к самому приятному процессу — склейке цветов. Используем для этого термопистолет.


Начинать лучше с крупных цветов, а после использовать более мелкие цветы, листья и лепестки. Бутоны распечатайте немного наклонив вниз, чтобы наш водопад цветов выглядел более естественно.
Не забудьте про обратную сторону провода. Это также нежный цветок.
Приклеиваем цветы на блюдце. Попробуйте приклеить их так, чтобы создавалось впечатление, что цветы плавно перетекают из кружки в блюдце.

Разнообразие поделок стремительное, а также разнообразие самых тем, на которые можно фантазировать. В зависимости от того, что есть дома под рукой и мастера, они выполняют различные поделки, которые потом радуют глаз. С нашими инструкциями в статье по созданию летающей чашки в простом и понятном мастер-классе справятся взрослые и дети.

На сегодняшний день сложно предположить, что еще придет вашим рукодельницам и мастерицам. Поэтому, опережая события, представляем вашему вниманию мастер — класс по топиарию летающей чашечки своими руками с подробной инструкцией и пошаговым описанием действий.

Чашка используется для различных действий И она многофункциональна, но кто бы мог подумать, что из нее можно соорудить топиарий. А на самом деле МК на кофейную чашку, чашку с цветами, чашку с деньгами, чашку канзаши с цветами, чашку со сливками и другие аксессуары отличный набор.

Мастер-класс по созданию летающей чашки с цветами в домашних условиях вы увидите ниже. В статью включены фото и видео отчеты по изготовлению топиарии.

Разбираем простой пошаговый мастер-класс по летающей чашке

Вам потребуется:
  • Чашка
  • Блюдце
  • Горячий клей
  • Искусственные цветы
  • Проволока.

Поделки порадуют оригинальностью и интересным воплощением.

Пошаговое изготовление упаковочного стаканчика с цветами:
  1. Проволочный сгиб в виде буквы «г». Приклейте его клеем к чашке с внутренней стороны и к блюдцу сверху.
  2. Каждый цветок, начиная сверху, приклейте к проволоке.
  3. Дойдя до блюдца сделайте цветочную поляну.

Ваша дымящаяся чашка с цветами готова!

Топиарий – это небольшие изделия из недоразвитых инструментов, которые имеют дома, например, искусственные цветы, ракушки, камушки.

Очень красивый подарок — сувенир, сделанный своими руками. Искусство создания топиариев берет свое начало от основ древней флористики. Как известно, флористика – это наука о поделках из цветов. Много веков назад Сюжетное искусство зародилось в Древнем Риме, откуда уже получило распространение в Европе.

Вскоре это стало достоянием и умением монахов. Там за закрытыми дверями И заборами монахи творили чудеса с кронами деревьев.

Для их создания используются самые разнообразные материалы и техники.В основном топиарии изготавливают в виде небольших деревьев, имеющих шаровидную или конусообразную форму. Их украшают цветами, перьями, стразами, камнями, крупами, листьями, шишками и другим декором, который придет на ум. Считается, что Топиарии — это «дерево счастья», поэтому их принято дарить близким людям. Особенно ценятся сувениры, сделанные своими руками, в которые мастер «вкладывает душу». Что касается декора, то здесь существует множество индивидуальных вариаций, все зависит от того, что придется вам по вкусу.

Еще один занимательный вариант изготовления топиарии – поделка в виде чашки кофе или парящих в воздухе цветов. Этот вид топиария будет актуален в качестве декора на кухне или в столовой.

Есть еще несколько способов изготовления топиария из кружки. Мы продемонстрируем один из них. Необходимо иметь:

  • Чайный набор — 1 экз.
  • Маленькие искусственные цветы
  • Клей Пистолет и стержни
  • Проволока, желательно тщательная
  • Passatii
  • Scotch malaria Scors 7.7 7.7979 81778 Аксессуары 7.7979 81778
Действия для пошаговой топиарии:
  1. Подготовить чашку с блюдцем — помыть, хорошо вытереть насухо.
  2. Берем проволоку, сгибаем ее с помощью прохода в виде буквы «г» с окончанием в виде завитка или зигзага.
  3. Придайте нужный изгиб, выравнивая основание проволоки, она должна плотно прилегать к стенке чашки и дну блюдца.
  4. Начать работать ружьем. Прилепите проволоку ко дну блюдца, дождитесь полного высыхания/остывания клея.Проволока должна полностью утонуть в клее.
  5. Как написано выше, приклейте проволоку с чашкой. Важный момент — Загружайте полное остывание клея всегда, когда используете его в своей работе.
  6. Протрите малярным скотчем проволоку. После приклеивания цветов.
  7. Принт на дне листьев блюдца.
  8. Украсьте чашку по своему вкусу, приклеивая цветы и аксессуары в произвольном порядке.

Топиарий Парящая цветочная ваза готова. Украсьте свой интерьер и подарите им!

Изделия ручной работы всегда были популярны и пользовались спросом.Ведь приятно осознавать, что подарок, который был вручен лично тебе. Это говорит об особом уважении гостя к вам и вашему дому. Каждый человек, у которого есть желание и немного фантазии, сможет выполнить это изделие самостоятельно в домашних условиях.

Такие поделки несут в дом тепло, радость и добрые пожелания.

Видео на эту тему в ссылке ниже

И процветание. Создание упаковочного стаканчика своими руками — процесс творческий, очень увлекательный и малозатратный, а результат его порадует!)

Летающая чаша выглядит очень привлекательно и придаст дополнительный уют и уют любому интерьеру дома или офиса.Он может стать отличным подарком для ваших близких и коллег! Сделать парящую кружку не составит большого труда, главное знать основной принцип ее изготовления и уделить особое внимание деталям и цветам.

Мастер — Овчинникова Ярослава

Материалы

1) Чайная или кофейная пара (чашка с блюдцем)

2) клей Для соединения конструкции «переливание» с миской и блюдцем. Лучше использовать универсальный гель-клей «Момент» для керамики, пластика или стекла.Альтернативой может служить любой другой клей, предназначенный для работы с гладкими поверхностями. Также используется клеевой пистолет, но он предназначен в основном для работы с шероховатыми поверхностями. Есть вероятность, что чашка сломается в ближайшее время, после склейки.

3) толстая проволочная или тройная проволока. Можно использовать и другие предметы из колодца, например, старые алюминиевые вилки или ложки, металлическую вешалку.

суперпласт ) — самотвердеющий термопласт. При нагревании он становится пластичным и ему удобно придавать необходимую форму.При охлаждении становится твердым, эластичным и прочным.

5) малярия скотч — Им можно заменить суперпластик

6), также может заменить полиморфус. Он напоминает пластилин, но в отличие от него хорошо твердеет на воздухе. Содержит в своем составе натуральные компоненты (тесто из муки крупного помола), поэтому абсолютно безопасно для детей.

7) предмета декора Чашки: монеты, цветы, шишки, перья, конфеты, бусы, пуговицы, ленты и многое другое.

Процесс сборки стаканчиков

Процесс создания парящей кружки совсем не сложен, но есть несколько важных нюансов, которые необходимо учитывать при ее создании.

Главный секрет создания летающей чаши – правильный выбор чайной пары. Чашка и блюдце не должны быть слишком тяжелыми. Если учесть это условие — летающую чашу создать будет проще!

Сооружаем основу упаковочной чашки, это элемент, который соединяет блюдце с чашкой.Для этого берем проволоку нужной длины. Важно учитывать, что расстояние между чашей и блюдцем должно быть примерно две чашки. С такими параметрами летающая чашка будет смотреться максимально сбалансированно.

Внутри чаши сформировать петлю из проволоки, диаметр которой должен быть 2-4 см. Это поможет добиться лучшей фиксации проволоки в чашке. Второй конец проволоки закручивается в плоскую спираль в два-три витка. Таким образом, у нас получится своеобразная подставка, которую мы закрепим в блюдце.

Радиус наклона получившейся конструкции не должен превышать 45 градусов, иначе конструкция будет неустойчивой!

Полиморф — все самое лучшее Материал При изготовлении летающей чашки.

Берем кусочек полиморфуса, погружаем в горячую воду на 20 секунд. За это время материал превращается в мягкий пластик.

Получается пластичностью, как пластилином, ложится основа, придавая подтянутую форму.Если пластик застыл до того, как вы успели закончить работу, то просто снова опустите его в горячую воду. Подготовленная основа полностью осветлится в течение 15 минут.

Если под рукой не оказалось, можно использовать массу для лепки. Альтернативой этим двум материалам может стать мальян скотч, который просто будит проволочную основу. Либо можно обмотать проволоку войлоком или другой тканью, предварительно промазав клеем.

Важный аспект — постоянная примерка основы на блюдце с чашкой, чтобы вовремя увидеть недостатки!

Особое внимание следует уделить краю чашки в том месте, где будет крепиться дизайн!

В этом месте надо сделать своеобразный шаг в виде бекапа.Так конструкция будет держаться гораздо надежнее.

Когда основа готова, можно приступать к ее закреплению на чашке. Смажьте клеем все соприкасающиеся поверхности основы с блюдцем и чашкой. Сильно прессуют и выдерживают 3-5 минут. Не забудьте приклеить ступеньку для опоры чашки!

Закрепите летающую чашку на мягких предметах в правильном направлении и оставьте в таком положении на 5 часов. За это время клей хорошо высохнет и надежно закрепит получившуюся парящую чашу.

Когда паровая чашка идет хорошо, необходимо проверить, насколько она стабильна.

Если блюдце не способно удержать чашку, то необходимо уменьшить радиус наклона конструкции до того, как она станет устойчивой.

Последний этап изготовления летающей чаши самый интересный и креативный. Украшаем наливную чашку! На декоративные элементы наносим клей-гель и клей.

Сначала лучше приклеивать крупные элементы, а более мелкие приклеивать в последний виток.Это позволит скрыть небольшие видимые недостатки и зазоры между элементами.

После того, как все украшения приклеены, стаканчику дать постоять 5 часов, чтобы клей высох.

Подробнее Процесс сборки летающей чаши рассмотрен в мастер-классе
Hand-Made от MasterClassy:

Летающая кружка

Ната Лиана рассказывает, как сделать дымящуюся чашку «Летнее настроение»:

Летающая кружка с фруктами и ягодами

С помощью пластиковых фруктов, ягод, грибов можно создать вот такое фруктово-ягодное изобилие, уходя из чашки.прекрасно дополнит ваш фруктово-ягодный

Подглядывающую чашку можно украсить яркой Дарой Осени. Также можно использовать сухие листья и цветы. Круг можно заменить деревянной бочкой из простых табуреток для мороженого.

Цветы и фрукты гармонично сочетаются в парящем потоке. Бабочки, стрекозы, божьи коровки станут прекрасным «живым» дополнением.

Парящая кружка

Парящая кружка выглядит очень стильно.Дизайнерский прием Использование неограниченной молнии также придаст оригинальности вашему кругу. Ключи, колокольчики, старые маленькие игрушки — все можно использовать как элементы декора вашей кружки.

С монетами вы также можете использовать поддельные купюры, в которых.

Секреты создания денежной кружки вы найдете в видеоуроке Sveta DIY:

Денежный журавль создается по тому же принципу, что и летающая кружка. Вместо кружки соответственно используйте пластиковый кран, а блюдце может заменить небольшой сундучок или .Монеты будут смотреться более эффектно, если их покрыть золотой краской из баллончика или лаком.

Мастер — Анастасия Спицына

Денежные потоки можно изобразить с помощью бумажных купюр.

Мастер — Оксана Анкудинова

Как сделать денежного журавлика можно увидеть в мастер-классе
Подарки своими руками:

Летающая кружка с птицами

Птица – символ легкости и свободы, очень часто встречающийся в интерьерных решениях в разных стилях и вариациях.Этот мотив отразился и в декорациях парящей кружки.

Кролик-заяц может стать прекрасным домиком для гнезда с птицами. Гнездо напоминает дом И идиллию в нем.

Чашка с ромашками и птичка с гнездом — настоящий символ семьи, любви и верности.

Птичка с нежными розочками, порхающие бабочки и другие элементы декора помогут создать летнюю наземную композицию.

Летающую чашку можно украсить простыми макаронами.Макароны лучше взять в виде бантика, покрасить их акриловой краской, главное украсить жемчугом. Украшаем кружку и водопад из букетов готов!

Такая кружка шикарно смотрится как в пастельных тонах, так и в классических красках — черный с белым.

Летающая кружка из бисера

Жемчуг — самый благородный элемент декора, который придаст праздничности и помпезности любой поделке! Простая пара белого чая может превратиться в такое жемчужное чудо!

Очень нежная парящая чаша получится из нежно-розового и в тон жемчуга.Белые голуби прекрасно дополнят композицию).

Бусины разные цветы Также помогут создать уникальный бесплатный опрыскиватель. Цветы и ленты того же оттенка, что и круг, прекрасно украсят круг и завершат образ вашей чашки.

елочки также можно сделать из новогодней зеленой мишуры. Имитировать снег на них можно белой краской или простым корректором для записей. Действующие лица Вы можете определить сами, создавая свою новогоднюю историю в парящей чаше!

Свеча подарит тепло и свет вашей чашке

Элементы декора для чашки можно создать своими руками практически из ничего, например такие маленькие не составит особого труда.Вы можете оставить записку с пожеланиями в виде небольшого конверта

Праздничное новогоднее настроение подарит летающая чашка, украшение, цветы и.

Сделайте свою пышную и умную:

Шедевры рукоделия, освещенные в мастер-классе по изготовлению пасхальной сушилки:

О другом виде пасхальной композиции рассказывается в мастер-классе Делкиру:

Необычные летающие чашки

Вместо летающей чашки можно сделать летающий котел.Такая композиция будет очень оригинально смотреться на вашем кухонном столе. При выполнении такой поделки варочный котел лучше выбирать небольшого размера и веса, чтобы не перегружать конструкцию. «Выливную струю» из чайника лучше делать из тонкой, прочной проволоки (например, спицы) и суперпластика.

Оригинальным украшением украшения могут стать подвесные летающие чашки с цветами! Главное надежно их зафиксировать.

Рубрики

Совершенно легко и по-настоящему уникально сделать самостоятельно такой сувенир, как упакованная чашка с интересным декором И с цветами, быстро и поэтапно.В настоящее время в рукоделии все чаще используются самые разнообразные и, порой, совершенно необычные и неожиданные техники и материалы.

Особо пристальное и детальное внимание хотим уделить такому прикладному творчеству, как топиарии с использованием разнообразных основ и материалов. Топиарии могут иметь не только форму миниатюрного красивого деревца. Их можно украсить как дымящуюся чашку с самым разнообразным и неординарным наполнением и декором.

Чашка столовая обыкновенная с посевом может использоваться не только по своему функциональному назначению.Если включить свою фантазию и творческий потенциал, то сделать из этих предметов необыкновенный декоративный топиарий легко и просто. В качестве наполнителя такой необычной чашки можно использовать монетки, живые или искусственные цветы, кофейные зёрна, цветы в технике канзаши и многое другое по своему усмотрению и желанию.

Для создания декоративных топиариев используется огромное разнообразие материалов и техник. Преимущественно топиарии изготавливают в виде небольших деревьев, имеющих шаровидную или конусообразную форму.Их украшали цветами, перьями, стразами, камнями, крошкой, листьями, шишечками и другим декором, который придет на ум. Считается, что Топиарии — это «дерево счастья», поэтому их принято дарить близким людям.

Предлагаем вашему вниманию подробный мастер-класс с пошаговым описанием Действия и манипуляции по изготовлению упаковочного стаканчика с цветами.

Изучаем мастер-класс по изготовлению упаковочного стаканчика своими цветами

Прежде чем приступить к манипуляциям по изготовлению неординарной топиарии с кофейным или чайным стаканчиком, подготовьте все необходимые инструменты и материалы.Итак, вам нужно будет работать:

  • Парные предметы: кофейная или чайная чашка и блюдце;
  • Искусственные цветы;
  • Вкусные конфеты;
  • Прочная металлическая проволока;
  • Розовые бумажные салфетки;
  • Клей канцелярский ПВА;
  • Щетка;
  • Двусторонний скотч;
  • Клеевой пистолет с горячим клеем;
  • Стержни для клеевого пистолета;
  • Ножницы;
  • Плоскогубцы;
  • Декоративные элементы: бусины, ленты, стразы и т.д.

После подготовки всего необходимого инструмента и материалов приступаем к изготовлению упаковочного стакана.

С помощью плоскогубцев отделите нужный отрезок металлической проволоки. Полученный кусок изгибается в виде лавины или водопада. Всю эту конструкцию перекроет двусторонний скотч или медицинская лейкопластырь.

Затем поверх проволочной основы положите бумажные салфетки. Наклейте и соскребите салфетки с помощью ПВА до той толщины, которую вы хотите получить в конечном итоге.Оставьте всю конструкцию до полного высыхания.

После того, как вся ваша конструкция из проволоки и бумажных салфеток полностью высохнет, соедините ее с чашкой и блюдцем. Слепить и зафиксировать эти элементы необходимо с помощью горячего клея. В этом случае фиксация будет надежной и долговечной.

Теперь можно приступать к творческому и приятному процессу изготовления упаковочного стаканчика — декорации. Возьмите выбранные искусственные цветы и отрежьте ножницами головку цветка от стебля. Нарезаем головы и листья горячим клеем.Подключить к конструкции провода. Расположение бутонов и листьев выбирают на свое усмотрение и творческое восприятие. Между цветочными кустами вставьте сладкую и вкусную конфету. Закрепить сладости также можно легко и быстро с помощью капельки горячего клея.

После того, как вы заново настроите «переливание» содержимого стаканчика, можно приступать к декорированию самой основы. Чашку кофе или чая можно украсить атласной или репсовой лентой, бабочками, бутонами, божьими коровками и прочим. Декоративные дополнительные элементы Чашечки лучше всего подбирать к цветочным компонентам основной цветовой гаммы композиции.Так вы сможете избежать резкого и броского контраста в готовой композиции.

Теперь можно взять золотые бусины или яркие слои и приклеить цветочные лепестки или листочки.

Ваша чашка для приготовления на пару готова!

Подборка тематического видео по теме статьи

Предлагаем вашему вниманию подборку видео по вышеуказанной теме. Надеемся, что изученный материал будет вам интересен и полезен. Приятного просмотра!

Даже будучи взрослыми, мы все любим чудеса.А если предусмотрено сделать чудо своими руками, то на первом месте будет дымящаяся чашка с цветами. Сделать это совсем несложно, а будет выглядеть так, как будет выглядеть из нее, как из рогов изобилия, неизвестно куда льется поток ярких красок.

Цветочный поток

Секрет в том, чтобы расположить чашку под прямым углом. Если вы хоть немного ошибетесь, волшебство исчезнет. Поделка будет похожа на чашку с красками, как будто на чашку с цветами.Обратите на это внимание, когда будете делать свой продукт. Например, здесь: Хотя работа выглядит аккуратно и цветы очень красивые, из-за неправильного угла наклона чашки и непостоянной формы «ручейка» композиция в целом выглядит как пирамида из цветов, увенчанная вершиной. с чашкой.


Помимо угла наклона чашки, важна толщина «струи», она должна выглядеть естественно. И тогда это уже не «парящая чаша». Если «ручей» слишком жирный, он не будет похож на струю, получится гора.

Должна быть такая чашка из чашек, блюдец и цветов, чтобы создавалась явная иллюзия того, что чашка висит в воздухе и из нее «вытекают струи». Ниже на фото вы можете увидеть работы, где эти детали продуманы и смотрятся идеально.


Разберемся пошагово.

Подготовка материалов: толстая проволока, прочный клей, скотч, пистолет с термоклеем, искусственные цветы, выполненные в любой технике, из фоамирана, из ткани и др., красивая чашка с блюдцем, ножницы.

От проволоки отрезаем два отрезка, равные высоте чашки над уровнем блюдца. Обматываем их друг с другом лентой. Чашка и блюдце обжимаются наждачной бумагой в тех местах, где они будут приклеиваться к проволоке.


Нанесите клей и оставьте на ночь для полного высыхания.

Подготовьте листья, веточки и цветы, которые будут использованы в композиции, продумайте, нарисуйте эскиз, чтобы хватило на всю струю и не было видно проволоки.

С помощью термосистемы по очереди аккуратно прикрепите заготовку.



Дополняем декор бусинами, лентами, божьими коровками или бабочками.

Второй вариант, когда конструкция делается из одного отрезка проволоки.

Из него формируются распорки и в блюдечке, и в чашке, чтобы площадь прилегания к клею была больше, это придаст поделке дополнительную устойчивость.

Использована обмотка проволоки в виде бумаги и ниток.

Вся поверхность насадки маскируется цветами, а это важно, т.к. «люмцы» портят общий вид изделия.

Цветы тоже используются разного диаметра, это очень красиво. Струя строго продумана и выглядит естественно.

При приготовлении материала не забывайте, что размер соцветий и листьев не должен быть больше самой чашечки, иначе это внесет диссонанс.Лучше использовать в массе мелкие цветы, а крупных всего несколько штук для придания объема всей композиции.

Такие чашки наполняют не только цветы. Это могут быть монеты, крупинки или натуральные материалы, в зависимости от тематики и времени года. Но принцип «натуральности» формы струи должен быть присущ формованию любого материала.

Следует отметить, что проволока для крепления чашки обтянута лентой не полностью, а также лучше намотать бумагу или шпагат.Это делается потому, что лента не выдерживает горячего клея и начинает сползать. Если провода нет, можно использовать старую вилку, которую нужно немного согнуть. Еще один вариант, который используют рукодельницы – монтажная пена для маскировки проволоки. После приклеивания проволоки к чашке и блюдцу рисунок «вспенивается» пеной, после высыхания ножа образуется «струя» и наносится декор. Так как таким образом можно придать струе естественный вид, то такие чашечки для замачивания выполнены с мелкими деталями – Бусинками, кофе, они не будут искажать форму струи слишком пышных форм.

(PDF) Рыбка данио Cacna1fa необходима для функции фоторецептора колбочек и формирования синаптической ленты Центру визуализации в Детской исследовательской больнице Св. Джуда за помощь по номеру

с электронным и конфокальным микроскопом, а также членам групп Тейлора и Байера по номеру

за помощь в скрининге мутагенеза и

по обслуживанию рыбных объектов.

Заявление о конфликте интересов. Ни один не заявил.

ФИНАНСИРОВАНИЕ

Эта работа была поддержана Глазным фондом рыцарей-тамплиеров —

(SJ), грантами Национального института здравоохранения (NIH)

EY12406 и EY13855 (HB) и Фондом Э. Матильды Циглер —

3

2 центр для слепых, Детская исследовательская больница Св. Иуды и

ALSAC (MRT). Конфокальная микроскопия и просвечивающая электронная микроскопия

были выполнены в Санкт-Петербургском медицинском центре.Jude Children’s

Исследовательский больничный центр визуализации клеток и тканей,

, поддерживаемый Национальным институтом здравоохранения, грант NCI P30

CA021765-34.

ССЫЛКИ

1. Choi, S.Y., Borghuis, B.G., Rea, R., Levitan, E.S., Sterling, P. and Kramer,

R.H. (2005) Кодирование интенсивности света синапсом фоторецептора колбочки.

Neuron, 48, 555–562.

2. Стерлинг П. и Мэтьюз Г. (2005) Структура и функция ленточных

синапсов.Trends Neurosci., 28, 20–29.

3. Schmitz, F. (2009) Создание синаптических лент: как они строятся и что они делают. Neuroscientist, 15, 611–624.

4. Том Дик, С. и Брандстаттер, Дж.Х. (2006) Ленточные синапсы сетчатки.

Cell Tissue Res., 326, 339–346.

5. Zanazzi, G. and Matthews, G. (2009) Молекулярная архитектура ленточных

пресинаптических окончаний. Мол. Neurobiol., 39, 130–148.

6. Jackman, S.L., Choi, S.Ю., Торесон В.Б., Рабл К., Бартолетти Т.М. и

Kramer, RH (2009) Роль синаптической ленты в передаче светового ответа колбочек

. Нац. Neurosci., 12, 303–310.

7. Сато С., Омори Ю., Като К., Кондо М., Канагава М., Мията К.,

Фунабики К., Коясу Т., Кадзимура Н., Миёси Т. и соавт. (2008) Пикачурин,

дистрогликановый лиганд, необходим для образования ленточного синапса фоторецепторов

. Нац. Neurosci., 11, 923–931.

8. Stohr, H., Heisig, J.B., Benz, P.M., Schoberl, S., Milenkovic, V.M., Strauss,

O., Aartsen, W.M., Wijnholds, J., Weber, B.H. и Schulz, H.L. (2009)

TMEM16B, новый белок с активностью кальций-зависимого хлоридного канала

, связывается с пресинаптическим белковым комплексом в окончаниях фоторецептора

. J. Neurosci., 29, 6809– 6818.

9. Дик, О., Том Дик, С., Альтрок, В.Д., Аммермюллер, Дж., Вейлер, Р.,

, Гарнер, К.C., Gundelfinger, E.D. и Брандстаттер, Дж.Х. (2003) Белок пресинаптической активной зоны

необходим для формирования синапсов фоторецепторной ленты

в сетчатке. Нейрон, 37, 775–786.

10. Allwardt, B.A., Lall, A.B., Brockerhoff, S.E. и Dowling, J.E. (2001)

Формирование синапсов задержано в фоторецепторах сетчатки мутанта nrc

рыбок данио. J. Neurosci., 21, 2330–2342.

11. Van Epps, H.A., Hayashi, M., Lucast, L., Stearns, G.W., Hurley, J.B., De

Camilli, P. and Brockerhoff, S.E. (2004) Мутант рыбки данио nrc обнаруживает роль полифосфоинозитидфосфатазы synaptojanin 1 в заякоривании ленты колбочки

фоторецептора. J. Neurosci., 24, 8641– 8650.

12. Трапани Дж.Г., Обхольцер Н., Мо В., Брокерхофф С.Е. and Nicolson, T.

(2009) Synaptojanin1 необходим для временной точности синаптической

передачи в волосковых клетках. Генетика PLoS,5, e1000480.

13.Хольцхаузен, Л.К., Льюис, А.А., Чеонг, К.К. и Брокерхофф, С.Е. (2009)

Дифференциальная роль синаптоянина 1 в фоторецепторах палочек и колбочек. Дж. Комп.

Neurol., 517, 633–644.

14. Wan, L., Almers, W. and Chen, W. (2005) Два гена рибай у костистых рыб: роль

рибайя в формировании лент и биполярных клеток разработка.

J. Neurosci., 25, 941–949.

15. Мэтьюз Г. и Фукс П. (2010) Различные роли ленточных синапсов в

сенсорной нейротрансмиссии.Нац. Rev. Neurosci, 11, 812– 822.

16. Bech-Hansen, NT, Naylor, MJ, Maybaum, TA, Pearce, WG, Koop, B.,

Fishman, GA, Mets, M., Musarella, МА и Бойкот, КМ (1998)

Мутации потери функции в гене альфа1-субъединицы кальциевого канала в

Xp11.23 вызывают неполную Х-сцепленную врожденную стационарную куриную слепоту.

Нац. Genet.,19, 264–267.

17. Ялканен Р., Мантиярви М., Тобиас Р., Изосомппи Дж., Санкила Э.М.,

Алитало Т.и Бех-Хансен, Н.Т. (2006) X-сцепленная колбочковая дистрофия,

CORDX3, вызывается мутацией в гене CACNA1F. Дж. Мед. Genet.,

43, 699–704.

18. Strom, TM, Nyakatura, G., Apfelstedt-Sylla, E., Hellebrand, H., Lorenz,

B., Weber, BH, Wutz, K. ., Gutwillinger, N., Ruther, K., Drescher, B. et al.

(1998) Мутация гена кальциевого канала L-типа при неполной Х-сцепленной

врожденной стационарной куриной слепоте. Нац. Ген., 19, 260–263.

19. Miyake, Y., Yagasaki, K., Horiguchi, M., Kawase, Y. и Kanda, T. (1986)

Врожденная стационарная куриная слепота с отрицательной электроретинограммой. A

новая классификация.Арх. Ophthalmol., 104, 1013–1020.

20. Chang, B., Heckenlively, JR, Bayley, PR, Brecha, NC, Davisson, MT,

Hawes, NL, Hirano, AA, Hurd, RE, Ikeda, А., Джонсон, Б.А. и другие. (2006)

Мышь nob2, нулевая мутация в Cacna1f: анатомические и функциональные

аномалии внешней части сетчатки и их последствия для ганглиозных клеток

зрительные реакции.Вис. Neurosci., 23, 11–24.

21. Doering, CJ, Rehak, R., Bonfield, S., Peloquin, JB, Stell, WK, Mema,

SC, Sauve, Y. and McRory, JE ( 2008) Модифицированная экспрессия Ca(v)1.4 у мыши

Cacna1f(nob2) из-за альтернативного сплайсинга ETn, встроенного в экзон

2. PLoS ONE,3, e2538.

22. Муто, А., Оргер, М.Б., Вехман, А.М., Смир, М.К., Кей, Дж. Н.,

Пейдж-МакКоу, П.С., Гахтан, Э., Сяо, Т., Невин, Л.М., Госсе, Нью-Джерси и другие.

(2005) Прямой генетический анализ визуального поведения рыбок данио.PLoS

Ген.,1, e66.

23. Билотта Дж., Сазик С. и Сазерленд С.Е. (2001) Вклад стержней в электроретинограмму

адаптированных к темноте развивающихся рыбок данио. Дев. Дин., 222,

564–570.

24. Ван Эппс, Х.А., Йим, К.М., Херли, Дж.Б., и Брокерхофф, С.Е. (2001)

Исследования синаптической передачи фоторецепторов и адаптации к свету у

зрительных мутантов рыбок данио nrc. Вкладывать деньги. Офтальмол. Вис. наук, 42, 868–874.

25. Stearns, G., Evangelista, M., Fadool, J.M. and Brockerhoff, S.E. (2007) Мутация

в специфичном для колбочек гене pde6 вызывает быструю дегенерацию фоторецептора колбочек

у рыбок данио. J. Neurosci., 27, 13866– 13874.

26. Bayley, PR and Morgans, CW (2007). . Дж. Комп. Нейрол.,500, 286 – 298.

27.Мансерг, Ф., Ортон, Северная Каролина, Весси, Дж. П., Лалонд, М. Р., Стелл, В. К.,

, Тремблей, Ф., Барнс, С., Ранкур, Д. Э. и Бех-Хансен, Н.Т. (2005)

Мутация гена кальциевого канала Cacna1f нарушает передачу сигналов кальция,

синаптическую передачу и клеточную организацию в сетчатке мыши. Гум. Мол.

Генетика, 14, 3035–3046.

28. Schmitz, F., Konigstorfer, A. and Sudhof, T.C. (2000) RIBEYE,

компонент синаптических лент: путешествие белка по эволюции

дает представление о функции синаптических лент.Нейрон, 28, 857–872.

29. Regus-Leidig, H., Tom Dieck, S., Specht, D., Meyer, L. and Brandstatter,

J.H. (2009) Ранние шаги в сборке ленточных синапсов фоторецепторов в

сетчатке мыши: участие сфер-предшественников. Дж. Комп. Neurol.,

512, 814– 824.

30. Магупалли В.Г., Шварц К., Алпади К., Натараджан С., Сейгель Г.М. и

Schmitz, F. (2008) Множественные взаимодействия RIBEYE-RIBEYE создают динамический каркас

для формирования синаптических лент.J. Neurosci., 28,

7954–7967.

31. Sheets, L., Trapani, JG, Mo, W., Obholzer, N. and Nicolson, T. (2011)

Рибай необходим для локализации пресинаптических каналов CaV1.3a и афферентной

иннервации сенсорных волос клетки. Развитие, 138, 1309–1319.

32. Catterall, W.A. (2011) Потенциалзависимые кальциевые каналы. Харб Колд Спринг.

Перспектива. биол., 3, а003947.

33. Лист, Л., Киндт, К.С. и Николсон, Т. (2012) Пресинаптический CaV1.3 канала

регулируют размер синаптической ленты и необходимы для поддержания синапсов в

сенсорных волосковых клетках. J. Neurosci., 32, 17273–17286.

34. Wagner, HJ (1973) Индуцированное темнотой уменьшение количества синаптических

лент в сетчатке рыб. Nature, 246, 53–55.

Молекулярная генетика человека, 2014, т. 1, с. 23, № 11 2993

Детской исследовательской больницы Святого Иуды 10 июля 2014 г. http://hmg.oxfordjournals.org/Скачано с

Как сделать бант из лент для елки.Мастер-класс «Как сделать бант из атласной ленты для волос или елки» с видео

Как украсить елку бантиками, фото

Каждый год в новогоднюю ночь все жители нашей страны заняты одним ВАЖНЫМ занятием — каждый наряжает свою новогоднюю елку! Для облегчения этой задачи в супермаркетах нашей страны набирают обороты продажи всевозможных новогодних игрушек: шариков, звездочек, домиков, шишек, зверюшек, снежинок, бантиков и даже сказочных персонажей…всего не перечесть!

Одни елки будут украшены в строгом дизайнерском стиле, другие будут пестрить всевозможными игрушками, а третьи — только редкими коллекциями…

Это все хорошо, но согласитесь, как же приятно делать новогодние игрушки своими руками, в кругу своей семьи, пропитанной эмоциями и весельем близких людей! Ни одна купленная игрушка не принесет такого эффекта!

Наш сайт предлагает вашему вниманию очень красивую новогоднюю поделку своими руками — шикарный пышный бант на елку, сделанный своими руками из ленточек!

Фото украшения елки бантиками

Эти бантики могут быть разных цветов и размеров.Эта елочная игрушка прекрасно впишется в любой стиль, будь то строгий, состоящий из таких вот бантиков, или веселый детский, где бантики — забавное дополнение к великому разнообразию новогодних игрушек.

Очень большой «плюс» таких бантов из лент на елку в том, что они очень быстро делаются! В любой час можно сделать десяток таких украшений!

Зачем столько луков? Ну, во-первых, вашу елку можно украсить только бантиками из лент, во-вторых, с помощью таких бантиков можно оформить любое свернутое в свиток и вставленное в праздничный яркий бант новогоднее желание, в-третьих, новогодние костюмы, стол и комнату тоже можно украсить забавными бантиками! Однако, в зависимости от применения, регулируйте размер самого лука!

Бантик на елку своими руками, мастер-класс

Давайте скорее начнем наш мастер-класс и вы узнаете все этапы создания такой елочной игрушки.

Приготовьте и положите перед собой:

  • Острые ножницы;
  • Яркая лента шириной 5 см;
  • Лента шириной 2,5 см;
  • Тонкая лента шириной всего 0,5 см;
  • Игла и нитка в тон лентам;
  • Обыкновенная зажигалка.

Чтобы сделать один бантик, нужно нарезать подготовленные ленты на мелкие кусочки:

  • Отрезок от самой широкой ленты (5 см) длиной 15 см — 4 шт.;
  • Кусочки ленты среднего размера (2.5 см) длиной 15 см – 5 шт.;

Подбираем по четыре ленты каждой ширины, аккуратно накладываем узкую ленту на широкую и выравниваем строго по центру!

И вот перед нами стоит очень важная задача: обеспечить плотное крепление двух лент, наложенных друг на друга, и принять меры, чтобы не расшатывались участки лент! В этом нам поможет обычная зажигалка! Благодаря ее вмешательству мы убьем сразу двух зайцев легким движением руки — избавимся от расшатывания и «сплавим» ленты между собой!

Делается это так: подносим зажженную зажигалку к краям лент и двигаем вверх-вниз — края начинают плавиться и гореть (не даем гореть, задуваем).У нас должен получиться ровный плавленый срез:

Посмотрите, как должны выглядеть четыре пробела:

Сгибаем наши ленточные заготовки пополам. Пришло время собрать все детали нашего лука воедино.

Для сборки используем обычный наметочный шов, вот так должно получиться:

Хорошо стягиваем на нитке, закрепляем — получается вот такая заготовка:

Как вы помните, у нас остался еще один кусок ленты, 2.Ширина 5 см, не использовалась. Его время пришло. Ставим этот отрезок перед собой, визуально намечаем его середину и сшиваем по этой линии уже знакомым обметочным швом:

Нить обрезать не нужно, просто пришейте ленту к готовой заготовке.

А теперь вспомним еще об одной тонкой ленточке! С этой лентой. При ширине всего 0,5 см аккуратно завяжем бантик по центру, украсим серединку, завяжем петельку — Бант НА ЁЛКЕ ручной работы, полностью готов!

Подумай.Что ваша коллекция не ограничится одним луком, а включенная фантазия будет работать с удвоенной силой, особенно когда увидит результат своего труда:

Фантазируйте, дерзайте, творите… удача на вашей стороне!

Сегодня многие предпочитают украшать ветки лесной красавицы не покупными фигурками, а сделанным своими руками новогодним декором. Сегодня разберемся, как сделать бантики на елку своими руками? С помощью наших мастер-классов вы создадите настоящие шедевры прикладного искусства.

Бантики на елку из лент своими руками, мастер-класс с фото

Такой бант из ленты отлично подойдет для украшения верхушки елки — оригинальная новомодная идея. Давайте креативить!

Перед началом работы необходимо запастись:

  • тканевая лента (скотч) 25 мм
  • репсовая лента 9 мм
  • ножницы
  • Шаблон
  • — картонный прямоугольник с прорезью посередине
  • зажигалка
  • хомуты
  • клеевой пистолет
  • нить с иглой

Пошаговая инструкция


Какие еще бантики на елку можно сделать своими руками, фото

Бантики из лент могут украсить не только елку, но и поздравительные открытки, и коробку с новогодним подарком.Вы можете подобрать ленты различных цветовых сочетаний и устроить настоящий новогодний «шотландский фейерверк».

На фото представлены различные варианты бантов, выполненные в едином стиле.




Елочный бант из ленты, мастер-класс

А теперь давайте рассмотрим еще один способ сделать бантики на елку своими руками — этот оригинальный мастер-класс очень легко освоить. Благодаря этому способу можно создать множество аккуратных бантиков за короткое время с минимальными материальными затратами.

Необходимые материалы

  • разноцветные атласные, атласные или нейлоновые ленты — ширина 0,5, 2,5 и 5 см
  • ножницы
  • нить с иглой
  • зажигалка

Пошаговая инструкция


Елочные бантики из лент в разных цветовых сочетаниях, фото



Как сделать бантики на елку своими руками, мастер-класс с фото

Наш третий мастер-класс посвящен изучению классического варианта создания этого вида елочных игрушек.

Необходимые материалы

  • нам понадобятся только разноцветные ленты из немнущегося материала (сатин, полиэстер, атлас).

Пошаговая инструкция


Как завязать бантики на елку?

Нитью, продетой с внутренней стороны изделия, можно ненавязчиво прикрепить бантик к новогодней елке. Для этой цели также используется тонкая резинка.

Особенный пышный бантик получится, если соединить несколько маленьких бантиков вместе.Берем атласную или атласную ленту длиной 60 см и разрезаем ее на три равные части. Каждую деталь сшиваем в бантик, который затем нужно склеить клеевым пистолетом. Получается объемное новогоднее украшение на елку. В качестве декора также можно использовать бусины, стразы и бисер.







Как сделать бантики на елку своими руками, видео

Бантики из лент, сделанные своими руками, придадут помещению нотку уюта и комфорта.А как процесс создания поделок сближает детей и родителей! Попробуйте вместе сделать, а затем украсить елку бантиками к Новому году 2016. Пусть это станет вашей семейной традицией. Смотрите наше видео с подробным мастер-классом и творите красоту!

Каждый год в новогоднюю ночь все жители нашей страны заняты одним ВАЖНЫМ занятием — каждый наряжает свою новогоднюю елку! Для облегчения этой задачи в супермаркетах нашей страны набирают обороты продажи всех видов: шарики, звездочки, домики, шишки, зверюшки, снежинки, бантики и даже сказочные персонажи…всего не перечесть!

Одни елки будут украшены в строгом дизайнерском стиле, другие будут полны всяких игрушек, а третьи будут только с редкими коллекциями…

Это все хорошо, но согласитесь, как же это приятно сделать новогодние игрушки своими руками, в кругу своей семьи, пропитанной эмоциями и весельем близких людей! Ни одна купленная игрушка не принесет такого эффекта!

Наш сайт предлагает вашему вниманию очень поделки своими руками, — шикарный пышный бант на елку, сделанный своими руками из лент!

Эти бантики могут быть разных цветов и размеров.Это прекрасно впишется в любой стиль, будь то строгий, состоящий именно из таких бантиков, или веселый детский, где бантики являются забавным дополнением к великому разнообразию новогодних игрушек.

Очень большой «плюс» таких бантов из лент на елку в том, что они очень быстро делаются! В любой час можно сделать десяток таких украшений!

Почему так много луков? Ну, во-первых, вашу елку можно украсить только бантиками из лент, во-вторых, с помощью таких бантиков можно оформить любое свернутое в свиток и вставленное в праздничный яркий бант новогоднее желание, в-третьих, новогодние костюмы, стол и комнату тоже можно украсить забавными бантиками! Однако, в зависимости от применения, регулируйте размер самого лука!

Давайте скорее начнем наш мастер-класс и вы узнаете все этапы создания такой елочной игрушки.

Подготовьте и положите перед собой:

  • Острые ножницы;
  • Яркая лента шириной 5 см;
  • Лента шириной 2,5 см;
  • Тонкая лента шириной всего 0,5 см;
  • Игла и нитка в тон лентам;
  • Обычная зажигалка.

  • Отрезок от самой широкой ленты (5 см) длиной 15 см — 4 шт.;
  • Кусочки из ленты среднего размера (2,5 см) длиной 15 см — 5 шт.;

Выбираем по четыре ленты каждой ширины, аккуратно накладываем узкую ленту на широкую и выравниваем строго по центру!

И вот перед нами стоит очень важная задача: обеспечить плотное крепление двух лент, наложенных друг на друга, и принять меры, чтобы не расшатывались участки лент! В этом нам поможет обычная зажигалка! Благодаря ее вмешательству мы убьем сразу двух зайцев легким движением руки — избавимся от расшатывания и «сплавим» ленты между собой!

Делается это следующим образом: подносим к краям лент зажженную зажигалку и двигаем вверх-вниз — края начинают плавиться и гореть (не даем сгореть, задуваем).У нас должен получиться ровный сплавленный срез:

Сгибаем наши ленточные заготовки пополам. Пришло время собрать все детали нашего лука воедино.

Как вы помните, у нас остался еще один кусок скотча шириной 2,5 см, неиспользованный. Его время пришло. Ставим этот отрезок перед собой, визуально намечаем его середину и сшиваем по этой линии уже знакомым обметочным швом:

А теперь вспоминаем еще об одной тонкой ленточке! С этой лентой.При ширине всего 0,5 см аккуратно завяжем бантик по центру, украсим серединку, завяжем петельку — Бант НА ЁЛКЕ ручной работы, полностью готов!

Подумай. Что ваша коллекция не ограничится одним луком, а включенная фантазия будет работать с удвоенной силой, особенно когда она увидит результат своего труда:

Фантазируйте, дерзайте, творите… удача на вашей стороне!

Здравствуйте дорогие читатели! Многие украшают домашние елки не только тематическими подвесками, мишурой, гирляндами, но и всевозможными бантиками, которые можно создать из атласных или упаковочных лент, органзы, бумаги.В рамках этого обзора сайт «Уют в доме» покажет, как делаются бумажные бантики на елку. В результате элементарных манипуляций получаются очень симпатичные и аккуратные бантики, которые на глаз не отличить от заводских.

Вот такие бантики из бумаги мы будем делать.

Что нужно для работы:

  • Листы бумаги (можно взять цветную или голографическую бумагу).
  • Клей.
  • Ножницы.
  • Мишура (по желанию).
  • Шаблон банта (см. ниже).
  • Принтер или возможность перерисовки.
  • Аэрозольная краска (дополнительно).

Бантик из бумаги на елку своими руками.

Необходимо распечатать или перерисовать приведенный ниже шаблон с деталями будущих бантиков.

Выкладываем три детали из одного бантика на плоскость.

Берем самую большую часть и капаем в ее центр клей. Приклейте крайние части детали к центру.

Наносим клей на центр заготовки в форме лепестка.И приклейте к нему ранее созданную заготовку.

На самую короткую часть в виде полоски нанесите клей на ее крайние стороны. И оборачиваем ею ранее склеенные детали.

Вот и готов лук!

По вышеприведенной схеме можно сделать много красивых бантиков. Которые потом при желании покрыть клеем и мелко нарезанной мишурой. Ну а если этого мало, то все бантики можно покрасить из баллончика. Вы можете изучить различные примеры дизайна лука ниже.

Традиция вешать на елку пышные красные банты пришла к нам из Европы.

Елка, украшенная атласными бантиками, выглядит очень нарядно и стильно.

Большую популярность завоевали их традиционные виды, то есть обычные одинарные луки.

Однако можно украсить елку и другими вариантами: например, красивыми двойными бантами или даже большими подарочными бантами.

Выбор их цвета будет зависеть от общей цветовой гаммы праздничного интерьера.

Очень большой «плюс» таких бантиков из лент на елку в том, что делаются они очень быстро. В любой час можно сделать десяток таких украшений!

Бантики на елку своими руками можно сделать как из атласной ленты, так и из цветной бумаги, а также оберток от конфет или фольги.

Для того, чтобы бантики на елку своими руками были красивыми и яркими, их следует украсить бисером и разным бисером.

Декор можно не только пришить, но и приклеить специальным клеем.

Цветные бантики разного «калибра» очаровательно смотрятся на елке, придавая ей праздничную нарядность.

Но украшая елку бантиками, не теряйте времени зря, ведь нужно оставить место для шишек, фруктов и игрушек. Однако любители оригинальности могут отказаться от других украшений.

Сами луки можно сделать так:

1. Привяжите прямо на еловые веточки прозрачные гофрированные ленты из органзы, опустив длинные концы вниз, как вы видите на фото.

2. Возьмите мягкие атласные ленты и завяжите бантик. В центр каждой пришейте по блестящей пуговице и оберните вокруг пуговицы тонкие елочные бусинки. У вас получатся красивые елочные бантики из бисера.

3. Из яркой подарочной бумаги нарежьте квадраты, перевяжите их посередине тонкой атласной лентой, которую завяжите бантиком. В результате получаются очаровательные двойные бантики.

Здесь можно «поиграть» с цветами: соорудить элегантные однотонные бантики или яркие цветные — как душе угодно.

Это простое, но очень милое украшение пригодится при оформлении зала, так что создавайте их побольше.

Цветы из декоративных лент, которыми украшают букеты, очень органично будут смотреться на елке.

Если они у вас есть, разместите рядом с бантиками — получится прекрасное гармоничное сочетание.

Еще один оригинальный вариант украшения елки бантиками заключается в том, что детские бантики аккуратно раскручивают по длине и развешивают на ветках елки в виде праздничной мишуры.

Можно связать несколько бантов вместе, чтобы получилась большая лента.

А чтобы места крепления бантиков не было видно, повесьте сверху несколько маленьких атласных бантиков по размеру.

Бантики не обязательно должны быть дополнением к какому-либо украшению. Они очень красиво смотрятся сами по себе.

Вы можете выбрать именно такой «наряд» на елку и использовать для этого бантики из лент и ткани красного, золотистого цвета или с рисунком.

Бантики в тон елочным шарам будут смотреться великолепно.Подойдут как простые варианты новогодних бантов, так и многослойные с замысловатыми узлами.

Украшение елки бантиками разных цветов и размеров прекрасно впишется в любой стиль, будь то строгий, состоящий только из таких бантиков, или веселый детский, где бантики являются приятным дополнением к великому разнообразию новогодних игрушек .

Голубые ленточки, рожки мороженого и музыка возвращаются, поскольку Ярмарка округа Мальхор набирает обороты

Животных регистрируют, участники готовы продемонстрировать джемы и желе, а ярмарка округа Малер и родео возвращаются после годичного перерыва из-за пандемии.

Вид с дрона на торгово-выставочный центр округа Малер в Онтарио за несколько дней до открытия ярмарки и родео 2021 года. (ОСТИН ДЖОНСОН/Энтерпрайз)

ОНТАРИО. На прошлой неделе, за четыре дня до начала Ярмарки округа Малер, офис Линель Кристиани был занят.

Кристиани, управляющая ярмаркой, разговаривала по телефону с судоходной компанией, отслеживая заказ браслетов, в то время как родители просили записать своих детей на мероприятия 4H и Future Farmers of America.

Тем временем вопросы родителей о пропусках на парковку и формах регистрации с лентами эхом раздались, когда волонтеры вошли в офис и попросили Кристиани дать рекомендации по следующему проекту.

— На самом деле здесь довольно спокойно, — сказал Кристиани.

Ярмарка откроется во вторник после годичного перерыва из-за пандемии Covid, и к тому времени большая часть подготовительных работ будет завершена.

Ярмарка представляет собой крупную логистическую операцию со множеством движущихся частей, как очевидных, так и скрытых.

Первый новый очевидный предмет, с которым столкнется посетитель ярмарки, — это ряд черных металлических ворот у четырех входов на ярмарку.

Кристиани сказала, что она разработала идею новых ворот четыре года назад и с помощью государственного гранта посетила отделения FFA по всему округу и поговорила с их консультантами, чтобы узнать, могут ли они внести свой вклад с помощью шаблонов дизайна.

«Мы хотели, чтобы в нашем учреждении участвовали дети. Ворота впечатляют, и это один из наших успехов», — сказал Кристиани.

Кристиани сказал, что главы FFA из Вейла, Ниссы, Харпера, Онтарио и Вейла спроектировали ворота. Затем завод Owyhee Metal Works в Ниссе построил все ворота, кроме главных ворот, которые были созданы Vale FFA.

Ворота стоят около 20 000 долларов, сказал Кристиани.

Кристиани сказал, что на грантовые деньги также был реализован проект по замене ванных комнат под трибунами для родео.

В этом году есть и более тонкие изменения.

Например, в каждом стойле в животноводческом помещении будут демонстрироваться штифты для снаряжения, куда можно складывать снасти, — сказал Кристиани.

«В 2019 году у нас их не было, — сказал Кристиани.

Долгий путь подготовки

Планирование ярмарки начинается более чем за девять месяцев до того, как распахиваются главные ворота.

Кристиани сказала, что в сентябре она начнет искать справедливых судей для животноводческих и сельскохозяйственных мероприятий. В этом году за сельскохозяйственными соревнованиями будут наблюдать восемь судей, а за животноводством делегированы 13 судей.

Кристиани сказал, что «выстраивание» судей включает в себя бронирование номеров в гостиницах, приобретение ваучеров на питание и определение ставки заработной платы.Судьи конных соревнований, таких как Western Equitation 4H для юниоров, стоят 1000 долларов плюс 500 долларов на транспортные расходы. Судьи крупного рогатого скота обычно берут 1000 долларов.

По словам Кристиани, выставка говядины, которая длится четыре дня, является крупнейшей на окружном уровне ярмарки в штате.

Выставка говядины начинается в среду, 28 июля, и завершается в субботу, 31 июля, аукционом, который начинается в 10:00.

Кристиани сказал, что в 2019 году на ярмарке было зарегистрировано 97 заявок на говядину, но в этом году было зарегистрировано 80.Кристиани сказала, что не уверена, были ли другие заявки в других категориях недоступны.

Кристиани сказал, что существует большая неопределенность относительно того, будет ли ярмарка в этом году. Она сказала, что в апреле начала готовиться к модифицированной версии ярмарки, которая будет меньше по размеру и с ожиданием, что будет меньше людей, допущенных из-за ограничений по всему штату.

Решение губернатора об отмене ограничений Covid на уровне штата от 30 июня создало новую парадигму для Кристиани и увеличило рабочую нагрузку.

Она сказала, что, по ее мнению, количество заявок уменьшилось, потому что люди не были уверены, что ярмарка состоится из-за Covid.

Линель Кристиани, менеджер торгово-выставочного центра округа Малер, выполняет задания в пятницу, 23 июля, когда ярмарка 2021 года готовится к открытию. (ОСТИН ДЖОНСОН/Энтерпрайз)

Волонтеры имеют решающее значение

Кристиани полагается на волонтеров, и ей всегда нужна дополнительная помощь.

— На этой ярмарке не хватит добровольцев, — сказал Кристиани.

Хорошим примером, по словам Кристиани, является Красный Амбар, где выставлены экспонаты, демонстрирующие все, от искусства до творений Lego.

«Наверное, у нас около 2000 записей. Так что на каждую запись должен быть бумажный след. Каждую запись кто-то должен отслеживать», — сказал Кристиани.

Она сказала, что в этом году ярмарка направит в Красный Амбар 48 добровольцев.

Кристиани сказал, что такие показы всегда собирают толпу.

«Мы не зарабатываем на этом деньги, но это очень популярно», — сказал Кристиани.

Волонтеры также заботятся о судьях, сказал Кристиани, обеспечивая их всем необходимым во время шестидневной ярмарки.

Ярмарка начинается во вторник

Жители могут начать приносить на ярмарку статические записи открытого класса в воскресенье, с 13:00. до 17:00 и с полудня до 19:00. Понедельник, сказал Кристиани.

Ярмарка официально открывается в 14:00. Вторник.

Кристиани сказал, что в этом году карнавала не будет, но будет множество других развлечений для молодежи, таких как водные горки.

На ярмарке также будет насыщенная развлекательная программа, которая начнется в пятницу в 19:00. когда художник Маззи Браун выходит на сцену в Центре мероприятий Desert Sage на выставочном комплексе.

Micky & The Motocars проведут концерт в 20:00. и группа Reckless Kelly открывается в 21:00.

Вход на концерт $5.

Традиционное родео, спонсируемое ICA, также будет представлено на ярмарке в этом году. Родео начинается в пятницу в 20:00. и открывается в субботу в 9 вечера.м. Также в субботу вечером EH-CAPA Bareback Riders из Айдахо спонсирует шоу на территории родео с 19:30 до 19:00. до 9 вечера

«Приходите и наслаждайтесь свободой без масок и вкусной едой. Поддержите свое сообщество», — сказал Кристиани.

  Подсказка? Свяжитесь с репортером Пэтом Колдуэллом по телефону [email protected]

ПРЕВОСХОДСТВО В ЖУРНАЛИСТИКЕ — доступно за 5 долларов в месяц. Подпишитесь на цифровой сервис Enterprise и получайте самое лучшее в местной журналистике.Мы сообщаем с осторожностью, вниманием к точности и непоколебимой приверженностью справедливости. Получайте новости, которые вы искали, изо дня в день от Enterprise.

идей, мастер-класс. Поделки из шишек к Новому году

Шишки — прекрасный материал, из которого можно сделать самые разные поделки. Кроме того, они обладают нежным, приятным ароматом хвои. Конечно, изначально такой материал выглядит не очень привлекательно. Однако если подключить фантазию, то из шишек можно сделать оригинальные украшения к празднику.При этом особых затрат не требуется. Практически каждый может сделать новогодний декор из шишек. Как это может быть сделано?

Подготовка материала

Декор из шишек всегда выглядит необычно и красиво. Главное знать, как правильно подготовить материал для поделок. Шишки, упавшие с дерева еще закрытыми, со временем постепенно раскрываются. При этом сосны внешне напоминают маленькие елочки, а ели — взъерошенных ёжиков. Конечно, изначально декор из шишек выглядит неординарно.Однако со временем поделки начинают деформироваться. Чтобы этого не произошло, при обработке материалов следует придерживаться определенных правил:

  1. Чтобы избежать раскрытия шишек, даже при понижении температуры в помещении следует опустить их на 30 секунд в столярный клей.
  2. Чтобы шишки, наоборот, быстро раскрылись, их рекомендуется прокипятить в течение получаса, а затем просушить на батарее. Также материал можно прокалить в духовке при 250°С в течение 2 часов. Эти методы позволяют не только добиться желаемого результата, но и убить все бактерии.Материал после обработки будет безопасным и чистым.
  3. Чтобы украшение шишек было красивым, можно подкорректировать форму материала. Сырье для поделки достаточно замочить в воде, а затем связать в нужном месте шпагатом и высушить.
  4. Чтобы сделать материал более светлым, можно отбелить. Для этого рекомендуется замочить шишки в емкости с хлоркой на 5 часов. При этом необходимо соблюдать пропорции. На одну часть воды требуется одна часть отбеливателя.В конце шишки следует тщательно промыть и просушить.

Какой декор из шишек можно сделать

Еловые и сосновые шишки натуральныеПриродный материал, с которым легко работать. Для изготовления декора из такого сырья достаточно один раз пройтись по лесу и собрать необходимое количество материала. После тщательной подготовки шишек можно сделать оригинальные и красивые вещи. Таким образом можно сэкономить на покупках дорогих новогодних украшений для помещения и для елки.

Стоит отметить, что из такого материала можно сделать массу интересных элементов декора. Это могут быть миниатюрные елочки, украшения на елку, венок на свечи или входные двери и так далее. Из этого материала можно сделать практически все. Достаточно подключить воображение.

Как сделать новогоднюю елку

Проведем небольшой мастер-класс. Из шишек можно сделать маленькие и оригинальные елочки. Для изготовления такого декора вам понадобится:

  1. Шишки.
  2. Пистолет клеевой.
  3. Ножницы.
  4. Воздушные шары с золотой или серебряной краской.
  5. Круг и конус из картона. Лучше использовать материал коричневого или зеленого цвета.

Этапы изготовления

Итак, как сделать декор из шишек? Для начала необходимо выбрать и подготовить материал. Конусы следует брать уже открытыми. Материал следует очистить от мусора, хорошо промыть и высушить.

После этого неровности должны быть покрыты ровным слоем краски.Так материал станет более праздничным. При желании можно этого не делать, если хотите сохранить естественность. Если шишки были окрашены, их следует хорошо просушить.

К конусу нужно приклеить круг. Двигаясь по кругу, на поверхности конструкции следует закрепить подготовленные шишки. Начинают с самого большого, постепенно уменьшая размер материала. Конусы должны плотно прилегать друг к другу. Необыкновенная елочка готова. При желании его можно украсить. Необычный декор из шишек способен придать интерьеру более праздничный вид.

Шар для праздника

Поделки из шишек на Новый год могут заменить даже самые нестандартные вещи. Например, многие видели на больших вечеринках свисающие с потолка светящиеся шары. Такой элемент интерьера можно сделать из сосновых шишек. Для создания такого изделия вам понадобится:

  1. Воздушный шар.
  2. Бумажный туалет.
  3. Клей ПВА.
  4. Краска коричневая.
  5. Конусы.
  6. Лента.

Изготовление заготовки для шара

Такую поделку из шишек к Новому году можно изготовить несколькими способами.Сначала нужно сделать заготовку. Его можно купить готовым, а можно сделать самому. Последний вариант интереснее. Необходимо взять воздушный шар и надуть его до необходимого размера. Теперь стоит его заклеить. Для этого шарик необходимо обернуть туалетной бумагой, предварительно смоченной в растворе клея ПВА. Его также можно приготовить дома. Для этого смешайте 1 часть клея ПВА и 2 части воды. Мяч, покрытый более чем одним слоем туалетной бумаги, следует оставить на 24 часа для просушки.

По истечении указанного времени заготовку следует покрыть коричневой краской. В противном случае материал будет виден сквозь неровности. Теперь его следует высушить.

Сделать шар

Когда заготовка готова, осталось приклеить к ней заранее подготовленные аккуратно комочки. В этом случае не торопитесь. Конусы должны быть близко друг к другу. Сверху нужно приклеить атласную ленту. Поделка готова. Вы можете повесить его под потолком или на люстре.

При желании в этот шар можно воткнуть палочку, поместив ее второй конец в горшок.Получается своеобразный топиарий.

Венок из шишек

Из еловых шишек тоже можно сделать необыкновенное украшение. Чаще всего их используют для создания новогоднего венка. Традиционно такое изделие плетут из лапника. Однако в последнее время венки стали делать из атласных лент и новогодней мишуры, украшая все это шариками и бумажными цветами. При желании можно создать елочные украшения из шишек. Вам понадобится:

  1. Степлер.
  2. Скотч.
  3. Газеты.
  4. Шишки еловые.
  5. Краска в баллончике, желательно коричневая.
  6. Ножницы.
  7. Пистолет клеевой.
  8. Бусины, ленты, еловые ветки и прочее.

Начало работы

В первую очередь необходимо сделать основу будущего венка. Если нет времени, можно купить уже готовую в специализированном магазине. Если такой возможности нет, то основу для венка следует сделать самостоятельно. Это будет намного дешевле. Газету необходимо скрутить в длинную трубочку, а затем свернуть бубликом.Края материала можно скрепить степлером. Такую заготовку рекомендуется дополнительно обернуть обрезанной газетой, а затем скотчем. Это не позволит готовому изделию деформироваться.

Чтобы скрыть материал подложки, необходимо покрыть заготовку равномерным слоем краски. После полного высыхания покрытия можно приклеивать шишки, заполняя ими все пространство. В завершение венок красиво украшаем, используя атласные ленты, бусины и веточки.Готовый венок рекомендуется покрыть лаком, чтобы сохранить его надолго.

Звезда из шишек

Этот новогодний декор из шишек может стать отличным украшением для ели. Процесс изготовления такой звезды достаточно прост. Вам понадобится:

  1. Ленты.
  2. Металлические шпажки или прочная проволока.
  3. Шишки еловые разных размеров.

Как сделать

Из проволоки необходимо сделать 5 одинаковых по длине шпажек.Их следует соединить, согнув по центру. Это будет основа для пятиконечной звезды. На проволоку необходимо нанизать шишки, собрав оригинальную композицию. Одну из веточек нужно согнуть и перевязать атласной лентой. Это позволит повесить готовое изделие возле камина, на стену или на дверь. Такую звезду можно закрепить на верхушке новогодней ели.

Елочные игрушки

При желании можно сделать оригинальный декор из шишек своими руками для новогодней елки.Изделия достаточно просты в изготовлении, долговечны и красивы. Как превратить простую шишку в произведение искусства?

Самый простой вариант – использование старых мягких игрушек небольших размеров. Для начала необходимо покрасить подготовленную шишку в соответствующий цвет, а затем прикрепить к ней голову игрушки. Также можно добавить хвост, лапы и крылья. Получилась оригинальная елочная игрушка.

Есть еще более простой способ изготовления подобных поделок. Для начала нужно покрасить шишечки в нужный цвет или покрыть блестками.В конце нужно прикрепить к игрушке аккуратный бантик из атласной ленты или несколько веточек сосны, а также бечевку. Изделие готово повесить его на елку.

С помощью фетра и фетра можно создать оригинальных сказочных персонажей из обычных шишек. Главное, крепко приклейте все детали. В противном случае игрушка со временем рассыплется.

Для изготовления украшения на елку можно использовать не только шишки, но и их чешуйки. Перед началом работы их следует аккуратно отделить от основы.Для изготовления игрушки понадобится заготовка. Его можно выполнить в виде животного. В этом случае для изготовления заготовки можно использовать пенопласт и папье-маше. К поверхности такой основы необходимо аккуратно приклеить шишки, а затем украсить их блестками, создав эффект снежного покрова.

Занимаемся с детьми

Шишки — отличный природный материал, который можно использовать для занятий с детьми. Однако наносить клей для скрепления деталей в этом случае не обязательно.Обычно для уроков используют пластилин. Стоит отметить, что процесс изготовления фигурок очень нравится детям. Кроме того, создание поделок позволяет развивать моторику рук, а также влияет на умственное развитие ребенка. Перед тем, как начать, следует прочитать несколько правил:

  1. Шишки должны быть хорошо просушены.
  2. Разнообразие размеров и форм материала позволяет развивать воображение ребенка.
  3. Мелкие детали фигурок можно сделать из пластилина и других подходящих для этого материалов.
  4. Если ребенку не больше 3 лет, то поделку можно делать только в одну шишечку. Для детей постарше можно придумать композиции из нескольких.

Лисички из шишек

Для изготовления лисички с детьми вам потребуется:

  1. Пластилин белый, оранжевый и черный.
  2. Конусы различных форм и размеров.

Для начала необходимо подобрать материал, который подойдет для изготовления туловища, хвоста и головы.Шишки следует соединить между собой пластилином или хорошим клеем. Заготовка готова. Осталось его украсить. Для этого из пластилина следует вылепить лапки, ушки, глазки, носик и мордочку животного.

Блестящий ёжик

Этого зверька можно сделать из одной красивой и большой шишки, которая уже полностью раскрыта. Осталось украсить отдельными деталями из пластилина. Для завершения необходимо слепить 4 лапы, уши, нос, глаза и мордочку животного.

Также можно слепить из пластилина тело ежика, а затем покрыть его чешуей шишек или маленькими шишками такого же размера.При желании спинку животного можно украсить грибочками и яблоками. Их можно слепить из пластилина.

Шишки и желуди

Декор из шишек на Новый год будет выглядеть более оригинально, если для его изготовления использовать желуди. Из таких материалов можно создавать красивые елочные игрушки. Для работы над декором вам понадобится:

  1. Желуди.
  2. Конусы.
  3. Тонкая атласная лента.

Добавить комментарий

Ваш адрес email не будет опубликован.